This is a test version of Biostars. For the public version, visit https://www.biostars.org.
bedtools multiple BAM files

I have BAM files in the external hard drive. Want to convert them into BED. Am using

cd /media/usr/LaCie/work/client/pool1/bam
for x in *.bam ; do
    echo "print current:$x";
    bedtools bamToBed -i "$x" > "${x%.bam}.bed";
done
echo "done"

it writes the BED files in the directory, but they are all empty. My BEDtools is installed in

/home/usr/miniconda3/bin/bedtools

Can someone tell me where I am going wrong? And the BAM files have reads, so there is no problem there. regards.

bedtools shellscript bamtobed
• 3,190 views • link
written by amitpande74 • amitpande74

change bamToBed to bamtobed (small letters).

• 0 views • link
written by husensofteng husensofteng 
(base) samtools view A1_S1.bam | head
NS500455:81:HTVKJBGXC:1:12305:10402:19515   16  chr1    231634  1   43M *   0   0   AGAATTGGGTTGGAATTTTGATGGGGATTGCATTGAATCTGTA <EE<A<EAEAEAA/EEAEEEEAAAAEEEEE/EEAAEEEA/EEE AS:i:86 XS:i:86 XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:43 YT:Z:UU
NS500455:81:HTVKJBGXC:2:22109:7726:14155    16  chr1    231634  1   43M *   0   0   AGAATTGGGTTGGAATTTTGATGGGGATTGCATTGAATCTGTA EEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE AS:i:86 XS:i:86 XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:43 YT:Z:UU
NS500455:81:HTVKJBGXC:3:22505:6042:9122 16  chr1    231634  1   43M *   0   0   AGAATTGGGTTGGAATTTTGATGGGGATTGCATTGAATCTGTA EE<E/<EAEEAEEEEAEA/EA<AEEEE<AEEE<<AAEAEEAEE AS:i:86 XS:i:86 XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:43 YT:Z:UU
NS500455:81:HTVKJBGXC:1:12101:2573:8192 0   chr1    312297  1   37M6S   *   0   0   TATATAATAAATGAATAAATCTTTAAAAAAAAAAAAGGCCTGA EEEEEAEA<EEEEEEEEEEEEEAEEEE<E<EAEEEAAEEAAAE AS:i:74 XS:i:74 XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:37 YT:Z:UU
NS500455:81:HTVKJBGXC:1:21211:14672:4155    0   chr1    312297  1   37M6S   *   0   0   TATATAATAAATGAATAAATCTTTAAAAAAAAAAAAGGCCTGA EEEEEEEEAAEEEEAEAEEEEEAEAAEEEEEEAEEAE/EAA<E AS:i:74 XS:i:74 XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:37 YT:Z:UU
NS500455:81:HTVKJBGXC:2:21107:10835:2883    0   chr1    312297  11  37M6S   *   0   0   TATATAATAAATGAATAAATCTTTAAAAAAAAAAAAGGCCTGA EEEEE6/E6A/AEA/EAAEEAEEE///<AAEEAEEEEEAEEA< AS:i:74 XS:i:73 XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:37 YT:Z:UU
NS500455:81:HTVKJBGXC:4:12504:22831:18864   0   chr1    312297  1   37M6S   *   0   0   TATATAATAAATGAATAAATCTTTAAAAAAAAAAAAGGACCTC EEEE/E/////E//<E<6A//E/AEEA6E/E/A////////// AS:i:74 XS:i:74 XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:37 YT:Z:UU
NS500455:81:HTVKJBGXC:3:21402:6383:13492    16  chr1    348070  1   44M *   0   0   AATTTGCAAATTCATCTGGAATAACAAAAAAACCAGGATAGCTA    EEAE<EEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEAEE    AS:i:88 XS:i:88 XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:44 YT:Z:UU
NS500455:81:HTVKJBGXC:1:22102:3644:3920 16  chr1    348071  1   43M *   0   0   ATTTGCAAATTCATCTGGAATAACAAAAAAACCAGGATAGCTA EEEEEEEEEAAEE<EEEEEEEEEEEEEEEEEEEEEEEEEEEEE AS:i:86 XS:i:86 XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:43 YT:Z:UU
NS500455:81:HTVKJBGXC:1:22303:6790:10657    16  chr1    348071  1   43M *   0   0   ATTTGCAAATTCATCTGGAATAACAAAAAAACCAGGATAGCTA EEAEEEAEEAAEA<AEE
• 0 views • link
written by amitpande74 • amitpande74

after I added a fake header to your sam, it worked fine on my machine.

$ for x in ~/jeter.bam; do echo "current $x"; bedtools bamtobed -i "${x}" > "${x%.bam}.bed" ; done && cat ~/jeter.bed
current /path/to/jeter.bam
chr1    231633  231676  NS500455:81:HTVKJBGXC:1:12305:10402:19515   1   -
chr1    231633  231676  NS500455:81:HTVKJBGXC:2:22109:7726:14155    1   -
chr1    231633  231676  NS500455:81:HTVKJBGXC:3:22505:6042:9122 1   -
chr1    312296  312333  NS500455:81:HTVKJBGXC:1:12101:2573:8192 1   +
chr1    312296  312333  NS500455:81:HTVKJBGXC:1:21211:14672:4155    1   +
chr1    312296  312333  NS500455:81:HTVKJBGXC:2:21107:10835:2883    11  +
chr1    312296  312333  NS500455:81:HTVKJBGXC:4:12504:22831:18864   1   +
chr1    348069  348113  NS500455:81:HTVKJBGXC:3:21402:6383:13492    1   -
chr1    348070  348113  NS500455:81:HTVKJBGXC:1:22102:3644:3920 1   -
• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

Is there a header? What does

samtools view -H A1_S1.bam | head

show?

• 0 views • link
written by GenoMax GenoMax

OP would have told us that there is an error message ...

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

Thanks @Pierre. I changed the cable of my external hard drive and now it works. Thanks to all for the kind support.

• 0 views • link
written by amitpande74 • amitpande74

1 answer

error: unrecognized command: bamToBed

bedtools bamtobed ....

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

I did correct it, yet it does not work.

• 0 views • link
written by amitpande74 • amitpande74

has the error message changed?

• 0 views • link
written by Friederike Friederike

Now there is no error message...giving an impression that it works. But still cannot see it in the top command.It has made an empty file in the folder titled .bed....am waiting to see if the script writes anything there. Shall keep you all updated. Thanks for the patience you people have shown.

• 0 views • link
written by amitpande74 • amitpande74

Log in to answer this question.

More posts like this
  • Automating busted in Hyphy
    written by Rijan • Rijan
    I am trying to run BUSTED in hyphy on 129 ortho files and corresponding treefiles. So, running it interactively is not applicable here. I am …
  • Bedtools: Merging Many Bed Files
    written by J • J
    I am using the algorithm CookHLA for my research. As part of its preparation, I need to feed it a bed file representing at least …
  • bbmap seal.sh error
    written by amitpande74 • amitpande74
    HI, While working with chipseq data I am getting this error on some chipseq fastq files: seal.sh in=/media/usr/LaCie/chip_seq/brain_chipseq/SRR823888_GSM1119239_Region_80_-_Pons_rostral_part_Brain2_H3K27ac_ChIP_Homo_sapiens_ChIP-Seq.fastq.gz ref=transcriptome.fa stats=Ventral_Anterior_Thalamic_Nucleus.sealstats.txt rpkm=Ventral_Anterior_Thalamic_Nucleus.rpkm.txt ambig=random java -ea -Xmx23714m …
  • bowtie2 shell script
    written by amitpande74 • amitpande74
    Dear All, I have tons of folders inside which I have fastq files, and these are single end reads.![folders][1] ![files][2] I want to write a …
  • bowtie2 making new indices
    written by amitpande74 • amitpande74
    Hi, I have a sequence which includes a transposon along with a gRNA >TE TGTATGTAAACTTCCGACTTCAACTGTA I want to find this in my sample fastq files. …
  • Error creating a new environment in Bioconda
    written by Optimist Optimist
    Please find the error report below and suggest a solution. Thank You (base) bio2@dmacsBioLinux8:~$ conda create --name circos_env Collecting package metadata (current_repodata.json): done Solving environment: …
  • Samtools Parse error at line 1
    written by storm1907 • storm1907
    Hello, I am trying to convert sam to bam and keep getting an error: The input file must be coordinate sorted and must have gone …
  • salmon shell script to automate quant
    written by amitpande74 • amitpande74
    Hi, I have 56 fastq.gz file in a folder called SRR. The files are paired end data and their names are SRR8068516_1.fastq.gz to SRR8068543_1.fastq.gz. The …
  • Is BED file generated by bametobed sorted ?
    written by pacman pacman
    We use bamtobed to covert bam files to bed files. I am wondering if the output is sorted by default , because our output bed …
  • failed to open BAM file
    written by zizigolu zizigolu
    Friends, ``` [izadi@lbox161 ~]$ bash [izadi@lbox161 ~]$ cd /usr/data/nfs6/izadi/gij [izadi@lbox161 gij]$ pwd /usr/data/nfs6/izadi/gij [izadi@lbox161 gij]$ ls S288C_rRNA.fsa my.sam SRR1944914.fastq my1.sam SRR1944914.sra my1_highquality.bam SRR1944914_trimmed.fastq my1_highquality.sam SRR1944914_trimmed_unmapped.fastq …