This is a test version of Biostars. For the public version, visit https://www.biostars.org.
bowtie2 aligment problems

Hi,

I have reads from DNA sequencing,5 pools. The reads look like this:

 @NS500455:80:HG7TNBGXB:1:11101:17723:1055 1:N:0:ATCACG
ACTTANGTGTATGTAAACTTCCGACTTCAACTGTATAGGGATCCNAGCTCCAATTCGCCCTATAGTGAGTCGTAT
+
/AAAA#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE#EEEEEEEEEEEEEEEEEEEEEEEEEEEEEE

It's illumina primer followed by the construct of a transposon which I had to filter. So, I used cutadapt:

for file in /FASTQ/*
do
  cutadapt -g ACTTAAGTGTATGTAAACTTCCGACTTCAACTG --discard-untrimmed --minimum-length=35 "$file" -o "`basename -s .fastq &
done

Then I tried aligning this with Bowtie2 using the command :

./bowtie2-align-s -x rat/rn4 -U A1_S1_R1_001.fastq --sensitive-local -S A_align.sam

Bowtie2 fails to align majority if them :

2648325 reads; of these:
  2648325 (100.00%) were unpaired; of these:
    2242006 (84.66%) aligned 0 times
    309307 (11.68%) aligned exactly 1 time
    97012 (3.66%) aligned >1 times
15.34% overall alignment rate

I tool the aligned and the unaligned sequences and used BLAT to figure out any contamination and to see if the sequences are from the rat genome. All positive. I don't have any clue as to why this is happening. Can someone help please. regards to all.

alignment next-gen bowtie2

Besides your issue, do you have paired-end data? It looks like it but I am asking if you can confirm this. If you are not sure, do you have two files for each sample, one containing "R1" in the filename and the other "R2"?

No the reads are single end. This is how the library was prepared.

Please use ADD COMMENT/ADD REPLY when responding to existing posts to keep threads logically organized. SUBMIT ANSWER is for new answers to original question.

What is your expected read structure? I guess you are interested in sequence to right of transposon insertion? You may also want to use bowtie v.1.x instead for bowtie v.2.x since the remaining read is small.

How long are the reads after trimming?

43 base pairs after trimming. The entire read length before trimming is 75bps.

You should also not run bowtie2 directly like this bowtie2-align-s. Use the wrapper script for bowtie2.

How should the command line be:

./bowtie rat/rn4 -s file.fastq test.sam

or should the specific read be specified. I have never used this before so could you kindly help.

Something like:

bowtie2 rat/rn4 -U file.fastq -S test.sam

0 answers

No answers yet.

Log in to answer this question.