This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to determine what allele a sample has from FASTQ data?

Hello!

I am interested in a particular gene, HLA-DRB1. I have around 10 samples that I have FASTQ (sequence) data files for. I also have a FASTA file which has all the alleles of HLA-DRB1. It is of this format:

>HLA:HLA01234 HLA-DRB1*1501 1152 bp
ATGGGGCTGGGCCCGGTCTTCCTGCTTCTGGCTGGCATCTTCCCTTTTGCACCTCCGGGA
GCTGCTGCTGAGCCCCACAGTCTTCGTTATAACCTCACGGTGCTGTCCTGGGATGGATCT
GTGCAGTCAGGGTTTCTCACTGAGGTACATCTGGATGGTCAGCCCTTCCTGCGCTGTGAC
AGGCAGAAATGCAGGGCAAAGCCCCAGGGACAGTGGGCAGAAGATGTCCTGGGAAATAAG......

My question is - how can I determine what allele each of my samples has?

Ideally, I'd just like a table that says something like..

sample_id        allele
ID_1             HLA-DRB1*1501
ID_2.            Ambigous

I had a look at a few programs but I'm not sure the best way to approach this.

rna-seq sequencing fastq fasta alleles

0 answers

No answers yet.

Log in to answer this question.