STRT-seq barcode file
does STRT-seq protocol has any barcode file?
AATGATACGGCGACCACCGATNNNNNNGGGXX..XXCTGTCTCTTATACACATCTGACGCXXXXXXXXTCGTATGCCGTCTTCTGCTTG i.e (21bp of Sequence) + (6bp UMI) + (Variable bp of Sequence again) + "GACGC" + (8bp Cell Barcode) + (Variable bp of Sequence again)
this is my barcode format, how should I write barcode pattern for UMI tool extract?
• 1,188 views
•
link
written
by
sara.behrozi7 •
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Using UMI-tools on Smart-seq3 RNA-Seq data
written by Agastya •
-
UMI extraction from 10X visium spatial transcriptome data
written by Omics data mining
-
Demultiplexing 10x fastq files by GROUPS of barcodes
written by bds1217 •
-
single cell RNA-seq in Galaxy
written by sara.behrozi7 •
-
How can I align single RNA seq(scRNAseq) data by using STAR or another aligner?
written by dhkwnr95 •
-
Demultiplexing single cell QIAseq UPX 3 Transcriptome Kits fastq files
written by user31888
-
How to move UMI tags to the header
written by newbinf •
-
How to append the cell barcode and UMI information to the fastq header in paired-end single-cell RN…
written by sc243 •
-
Trim read-specific adapter in paired-end reads
written by Nicolas Rosewick
-
Demultiplexing Conceptual Issue
written by asyndeton17 •
