single cell RNA-seq in Galaxy
hi. I am trying to analysis my single cell data in Galaxy. I have some big problems in first steps of barcode extraction. how should I make pattern for UMI tool extract and how should I find barcodes file?
barcode extraction
• 865 views
•
link
written
by
sara.behrozi7
0
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
How to get host and virus UMI count per cell with Bacterial genome data?
written by San 0Hello, I am working with bacterial genome fasta file. I have ran Virsorter2 tool to identify the viral regions. And i have annotated the viral …
-
With 10x Visum HD : How to map the barcode id to the barcode sequence ?
written by sacha 250Hi, I m trying to understand how 10x Visium HD for spatial transcriptomics works. Reading the [protocol][1] I understood that Read R1 harbors the UMI …
-
Regex in umi-tools doesn't identify pattern in non-beginning positions
written by kalaivani 1Hello, I have an example fq file (9_R2.fq.gz) that contains the following read: GAACCAACCTCTTCGGGTCTATATAGATAGGAAGAGCG... amongst others. I used the following code to extract cell barcodes …
-
UMI-Tools knee-method has great influence on the results of white list
written by Assa Yeroslaviz 197I have a single-cell RNAseq data set with a very long barcode structure, containing three BC (`N`, each 10nt long) separated by a fixed spacer …
-
Cell barcode whitelists for DNBelab C Series High-throughput Single-cell RNA Series Library Prepara…
written by benjamin.pyenson 0Hi, I am trying to use STARsolo to process some fastq files generated using MGI's technology (DNBelab C Series High-throughput Single-cell RNA Series Library Preparation …
-
ScRNA data
written by abbas.waseem.gcu 2I have a single cell paired end data 140 bp long, contain 140 bp in both files `_1` and `_2` with no barcode and UMI …
-
UMI extraction from 10X visium spatial transcriptome data
written by Omics data mining 26Hello everyone I have to analyse visium spatial transcriptome (ST) sequencing data (2 x150 bp) . I want to extract Spatial barcode and UMI from …
-
umi_tools using regex greedy quantifiers only returning 1 character
written by williamtmills 2I am trying to use umi_tools to remove UMIs and cell barcodes and leave the remaining sequence. Unfortunately, after correctly removing the umi and cell …
-
STRT-seq barcode file
written by sara.behrozi7 0does STRT-seq protocol has any barcode file? AATGATACGGCGACCACCGATNNNNNNGGGXX..XXCTGTCTCTTATACACATCTGACGCXXXXXXXXTCGTATGCCGTCTTCTGCTTG i.e (21bp of Sequence) + (6bp UMI) + (Variable bp of Sequence again) + "GACGC" + (8bp …
-
Demultiplexing and deduplicating using barcodes and UMIs in the "mate" read
written by lech.kaczmarczyk 5Hi All, I'd like to demultiplex and deduplicate reads using in-line barcodes from read2 and UMIs from the read1 and read2. The format is like …
Please post this over at Galaxy help forum: https://help.galaxyproject.org/