Thanks Jared. I had attempted to do this without success. Might be better to ask them if they have recommendations for this particular use case.
Hi all,
This may be a bit niche, but was hoping someone might have some guidance since I can't find any resources (will delete if not appropriate).
I've been trying to do scATACseq analysis using files generated from Biorad/ddseq standard pipeline. After processing the files per their standard workflow, I've only been successful in loading output files for monocole3/cicero into a cds object with count matrix, peak bed file, and barcodes.
I've been hoping to use ArchR, SnapATAC, Signac/Seurat etc. but these newer tools generally require fragments.tsv.gz file outputted by 10x cellranger-atac. In particular, I'm unsure how I can accurately quantify the duplicateCount column (indicated as PCR duplicates) or if there are reasonable work arounds.
I tried using sinto to generate this file with no luck. The bam file is formatted as such (combination of 4 samples from 2 conditions):
NB551136:29:HHKJ2BGX9:2:12310:8194:16161 99 hg19_chr10 60196 0 42M = 60328 172 CAAGGGATTGTCTTGGATTTTTCTGTTTCTCCCTCAATATCC EEEEEEEEEAEEEEEAEE<EAEAEEEEEEEEAAEAEEEEEEE NM:i:0 MD:Z:42 MC:Z:40M AS:i:42 XS:i:42 XA:Z:hg19_chr18,+14610,42M,0;hg19_chr2,+132562285,42M,1;hg19_chr14,-19357520,42M,1;hg19_chr22,+16469821,42M,1;hg19_chr1,-227726332,34M8S,0; XB:Z:TTGTAAGCGACACTTCAAGAC
NB551136:29:HHKJ2BGX9:3:13408:13804:3527 163 hg19_chr10 60294 0 40M = 60445 194 GTGTACAAAAGCCCCAAAGCATAATTTGTGCAGTTGAGCG AAAAAEEEEEEEEEEEEAEEEEEEEEEEEE<EEEAEAEEE NM:i:0 MD:Z:40 MC:Z:43M AS:i:40 XS:i:40 XA:Z:hg19_chr18,+14708,40M,0; XB:Z:TAGTGTTGAATCAACTAGAGC
Barcodes are formmated as such key/value relationship
TCGACAGGAATATGATAGGCA alignments.possorted.tagged_BC00001_N01
GTCCTTCCGAGTGGCCTCCTT alignments.possorted.tagged_BC00002_N02
CCAGTCATATGTGCCCTATGT alignments.possorted.tagged_BC00003_N02
Unfortunately, not sure how to proceed. Barcodes are kept after XB:Z: tag (specifying such for sinto unfortunately has not yielded results). Trying to generate fragments fails using various barcode arguments. Not sure if it's viable to re-format the bam, or I should re-process from fastq files (unfortunately cellranger-atac does not handle Biorad ddseq fastqs).
Fastq format is paired end, 4 lanes per sample, and 4 samples (2 conditions) that were merged into that bam file.
1 answer
ArchR can use bam inputs, see the inputFiles argument for the createArrowFiles() function. If you still run into issues, the devs may be able to provide some guidance on their Github if you open an issue.
I also highly recommend it for your analysis, it is very well made, though the devs are still working on getting every feature documented.
Log in to answer this question.