Hello! I have a FASTA file and I want to change their headers into a new name. Through searching here on this platform I have found some relevant questions and answers to my problem. Hence I decided to perform this purpose using some certain scripts which are recommended. E.g

awk '/^>/{print ">ASV" ++i; next}{print}' < file.fasta

and sed 's/>.*//g' filename.fasta

The problem with them is that changes are made, but not saved. Also a huge portion of sequences is removed...and I do the first sequences their headers are not named..any idea what could be the problem. I am using Linus konsol. My input sequences

> LTR-12
ATTGGAAAACAAACTATCCTACCTTCATCATACACTAGTGGTGCATATCACATGTATCAG
TAATATTTAGATGCAATAGCTATTGCCTAGTACTTTCATAAAGTAAACATCTTTATGACC

>Hmmer-14
ATGAAGGTAATAGAGCCTCAGGGTATACAATATTCAATGTATTTGTACCTTTTTCTGTAT
CTGGAAAGAGAACTCGAATCTGTTGTCCAGAAGTGCAATGGCTAAGTGCTATATAGAGTT

Expected output

> RLX-incomp-chim
ATTGGAAAACAAACTATCCTACCTTCATCATACACTAGTGGTGCATATCACATGTATCAG
TAATATTTAGATGCAATAGCTATTGCCTAGTACTTTCATAAAGTAAACATCTTTATGACC

>RLX-comp
ATGAAGGTAATAGAGCCTCAGGGTATACAATATTCAATGTATTTGTACCTTTTTCTGTAT
CTGGAAAGAGAACTCGAATCTGTTGTCCAGAAGTGCAATGGCTAAGTGCTATATAGAGTT

I have been followed all these question to try to solve my problem, but nothing works.

Question: Renaming Entries In A Fasta File

Question: How To Rename FASTA Headers

Question: Editing header of a fasta file

how to rename fasta file headers using sed

Modifying FASTA headers with Unix command line tools

Any script to parse fasta headers?