This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Remove whitespaces on fasta files, except on fasta-header

Hey everyone,

I have a multi-fasta file like this:

>NC_000914 464618..534825
gtgccttccattttggagcgggaccaaatcgcagcggttctggtaagtgcgagcagggac gtgccttccattttggagcgggaccaaatcgcagcggttctggtaagtgcgagcagggac
aaaacgccggccggcttgcgggaccatgcgatattacaactgctcgccacctacggactg aaaacgccggccggcttgcgggaccatgcgatattacaactgctcgccacctacggactg
cgatcaggagaaatccgcaacatgcggattgaggatatcgattggcggaccgaaaccatt cgatcaggagaaatccgcaacatgcggattgaggatatcgattggcggaccgaaaccatt

I would like to remove whitespaces from the fasta sequences, but keep the whitespaces on the fasta-headers (>). I use this command sed -i '/^>/ s/ .*//' file.fasta to remove whitespaces from fastaheaders, but now I want the opposite. Is this possible?

Thanks!

sequence
• 2,299 views • link
updated by cpad0112 cpad0112 • written by genomes_and_MGEs • genomes_and_MGEs

negate the headers in current command line. But be careful while using i and current commandline is not correct to remove only spaces in header.

• 0 views • link
written by cpad0112 cpad0112

Thank you for the reply. But how to negate that? Yes, I'll be careful with -i, thanks for the tip

• 0 views • link
written by genomes_and_MGEs • genomes_and_MGEs

/^>/! and current commandline removes space and any thing after that. Do not use that for this purpose. Try this: sed '/^>/! s/\s\+//g' test.fa

• 0 views • link
written by cpad0112 cpad0112

0 answers

No answers yet.

Log in to answer this question.

More posts like this