Add strain name directly on fasta header
Hey guys,
I would like to add the strain name in from of the corresponding nucleotide accession. I have a multi-fasta file with headers like this
>NZ_CP023010.1__3129429..3372047
atattgagctaaa...
>NZ_MRWY01000004.1__16177..110237
tcagtcgactcctcgc...
...
Could you please help me out? Thanks!
genome
• 702 views
•
link
updated
by
GenoMax
•
written
by
genomes_and_MGEs •
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Extract first and last column of fasta-header
written by genomes_and_MGEs •Hi everyone, I have a multi-fasta file name multi.fasta with the following structure: >A 124 B ATCGTA... >C 567 D GTCAG... My goal is to …
-
Remove whitespaces on fasta files, except on fasta-header
written by genomes_and_MGEs •Hey everyone, I have a multi-fasta file like this: >NC_000914 464618..534825 gtgccttccattttggagcgggaccaaatcgcagcggttctggtaagtgcgagcagggac gtgccttccattttggagcgggaccaaatcgcagcggttctggtaagtgcgagcagggac aaaacgccggccggcttgcgggaccatgcgatattacaactgctcgccacctacggactg aaaacgccggccggcttgcgggaccatgcgatattacaactgctcgccacctacggactg cgatcaggagaaatccgcaacatgcggattgaggatatcgattggcggaccgaaaccatt cgatcaggagaaatccgcaacatgcggattgaggatatcgattggcggaccgaaaccatt I would like to remove whitespaces from the …
-
Append fasta header to corresponding fasta filename
written by genomes_and_MGEs •Hey everyone, When you donwload a given assembly from Refseq NCBI, the filename with be for example GCF_006351845.1_ASM635184v1_genomic.fna and the corresponding fasta header >NZ_CP040904.1 Enterococcus …
-
Batch rename protein fasta headers
written by genomes_and_MGEs •Hey guys, I have tons of protein multi-fasta files and I would like to append the name of the file to the fasta-headers. For example, …
-
Rename fasta-header based on a list
written by genomes_and_MGEs •Hey everyone, I have a multi-fasta file like this >NZ_CP023010.1_3129429..3372047 atattgagctaa.. >NZ_MRWY01000004.1_16177..110237 tcagtcgactcct... ... And a list of fasta-headers like this >NZ_CP023010_Elizabethkingia anophelis FDAARGOS_198 >NZ_MRWY01000004_Klebsiella …
-
Extract fasta-headers that have the same word
written by genomes_and_MGEs •Hey guys, I have a multi-fasta protein file like this >SF_hydrolase MKG... >LH_reductase MKI... >SM_hydrolase MSN... Basically, I would like to extract only the fasta …
-
Rename several fasta-headers
written by genomes_and_MGEs •Hey guys, I have a multi-fasta file containing several extracted regions, such as >NZ_KI973281.1_1234..56789 atattgagctaaaaaaatcagttttccca... >NZ_LAAL01000032.1_5456..32476 tgcagaagtaagggggtaacaccatgcct... ... I would like to include strain name …
-
Extracting strain name from several assemblies
written by genomes_and_MGEs •Hey guys, Another question: Some of the outputs don't have the strain name. I guess the reason is that the organism name doesn't have that …
-
Batch rename RefSeq assembly for the corresponding organism name
written by genomes_and_MGEs •Hey everyone, I just downloaded several genomes from NCBI assembly. Let's say I downloaded all E. coli genomes. After unzipping all files, I'll have several …
-
Bash extract accession from FASTA header and add GI
written by anon •Hi all, I'm trying to create a pair of bash commands (or single command) to: (1) Extract $ACCESSION from a FASTA header from the format …
Hello genomes_and_MGEs!
Questions similar to yours can already be found at:
We have closed your question to allow us to keep similar content in the same thread.
If you disagree with this please tell us why in a reply below. We'll be happy to talk about it.
Cheers!