This is a test version of Biostars. For the public version, visit https://www.biostars.org.
concatenate sequence with new label in perl

Hi, I have a code to extract sequence from multiple fasta sequences and concatenate, and I want to add a new label; something like:

From

>seq1
ACAACCAGCTAGTCACCAAGTTACTGGCAGCACAAAAACAGTCGGCTGCGAATGACGATC
>seq2
CAACTGGCGTGTCATTCGCGGTTGCATCTCTGCTGATGAAAACGCAAACCTCGACAGAAG

to:

>new_label
ACAACCAGCTAGTCACCAAGTTACTGGCAGCACAAAAACAGTCGGCTGCGAATGACGATCCAACTGGCGTGTCATTCGCGGTTGCATCTCTGCTGATGAAAACGCAAACCTCGACAGAAG

My problem is in the print section, I want to add a new label just ones an all the sequences; I have try to use like

print 'New_label' . $seq;         # but it don't work

#!/usr/bin/perl -w
use strict;

open FASTA, "file.fasta" or die;
while(my $seq= <FASTA>) {
    chomp($seq);
    if ($seq =~  m/^>/ ) {
        next;
    }
    elsif ($seq =~ s/n|-//gi){
        next;
    }
    else {
         my $sequence =$seq;
        print $sequence;            #here is my problem
    }
}
close FASTA;
print "\n";

Thanks so much

fasta perl
• 3,576 views • link
updated by Ram Ram • written by cabraham03 • cabraham03

1 answer

if I understand your problem correctly, you need to print it at the beginning of the process, right just after the open and before the while, just as follows:

open FASTA, "file.fasta" or die;
print "New_label\n";
while(my $seq= <FASTA>) {

but if I really understand your problem correctly, a simple echo and grep combination would do:

echo "New_label" > newfile.fasta
grep -v "^>" file.fasta >> newfile.fasta
• 0 views • link
written by Jorge Amigo Jorge Amigo

Thanks so much Jorge; it's works well : ))) !!!

• 0 views • link
written by cabraham03 • cabraham03

If your problem got solved, please accept the answer by clicking on the green tick, which only you could see below the answer.

• 0 views • link
updated by Ram Ram • written by Deepak Tanwar Deepak Tanwar

This form of open works for historical reasons, but this should never be used in practice. It's much better to write it as:

open my $in, '<', "file.fasta" or die $!;

Specifying the mode and a lexical file handle will save you a lot of trouble!

• 0 views • link
written by SES SES 
#!/usr/bin/perl -w
use strict;
open FASTA, "file.fasta" or die;
print "New_label\n";
while(my $seq= <FASTA>) 
{
    chomp($seq);
    if ($seq =~  m/^>/ )
 {
        next;
    }
    elsif ($seq =~ s/n|-//gi)
{
        next;
    }
    else 
{
         echo "New_label" > newfile.fasta
        grep -v "^>" file.fasta >> newfile.fasta   
 }
}
close FASTA;
print "\n";

now its not working

• 0 views • link
updated by Ram Ram • written by Eva_Maria Eva_Maria

the echo and grep is an independent bash solution, not to be used inside a perl script. choose whatever you prefer:

bash:

echo ">New_label" > newfile.fasta
grep -v "^>" file.fasta >> newfile.fasta

perl (the whole previous code can be rewritten to this):

#!/usr/bin/perl -w
print ">New_label\n";
while(<>) { chomp; ! /^>/ and print }

you can remove the chomp if you don't need all the sequences to be in a single line. save it as script.pl, and call it as perl script.pl input.fasta

• 0 views • link
updated by Ram Ram • written by Jorge Amigo Jorge Amigo

Log in to answer this question.

More posts like this