Dear all,
I have downloaded some already published raw data (fastqs). Initially, I did QC and found adapter content in both forward and reverse reads.
Below you can see the fastqc details before adapter trimming of both forward and reverse reads:
To remove the adapter content I used cutadapt like below:
cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -o tr_sample_R1.fastq.gz -p tr_sample_R2.fastq.gz sample_R1.fastq.gz sample_R2.fastq.gz
With adapter trimming I see like below:
So, I have some questions:
1) Before adapter trimming, sequence length distribution was looking fine but after adapter trimming I see that something went wrong. Why is it like that?
2) I see that there is some bias in the first 10-15 bases. What I should do for that? Is it really a problem?
3) Why the GC content have multiple peaks?
Please clarify my doubts. thanks in advance.
2 answers
You can read here https://sequencing.qcfail.com/articles/positional-sequence-bias-in-random-primed-libraries/ about the bias in the first bases.
As to the sequence length distribution, just think of what cutting adapters means... Are reads expected to be of the same length, once you cut adapters, or not?
Log in to answer this question.
-
Adapter removal using cutadapt and multiqc report:
written by ayeraselvan •
-
Adaptor sequences in GIAB samples
written by Mk •
-
Increased GC content after trimming RNAseq data
written by guillaume.rbt
-
FastUniq deduplicate only working for forward read
written by Egelbets •
-
Remove adpater from reads
written by priya.bmg •
-
Error in sequence length distribution
written by bioinformatics.queries
-
Warnings in the Hisat2 alignment output files
written by newbie
-
Cutadapt wrong behaviour
written by dllopezr •
-
High A in "Per base sequence content" of fastQC report
written by DVA
-
weird insert size post trimming
written by badribio
