This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Blastx Result

I'm almost confused on blastx output length result. So the questions are:

Query= NODE_2160645-0;57 Length=82

ref|XP_002833304.1| PREDICTED: hypothetical protein LOC100444373 [Pongo abelii]

Length=134

Score = 37.7 bits (86), Expect = 0.74

Identities = 11/14 (78%), Positives = 14/14 (100%), Gaps = 0/14 (0%)

1)Query length has been reported 82! (but It's 57) ?!

2)The Identities number reported in Protein digit (the number of identities protein =11 so if want the number of base 11*3=33 bp) so the length of hit (134) is in bp or protein pare !? if it's in bp why it's not dividable by 3 ?! (the result 134/3 is not integer)

Thanks

Please help by posting the query sequence fasta entry (only NODE_2160645 !), blastx version and commandline parameters and the full alignment output for this hsp. That will give a reproducible example.

Because of formatting I put them in Answer part

1 answer

Question 1 Solved [It's human mistake]

NODE_2160645-0;57 GTAAGGTGAGAAAAAAAAAAAACGGAAGACTTGCCTTTCTCCAGTCCATTCCGTTCAATC CATTCCATTCCAGTCCATTCCA

blastx -query contigs.out -db nr .....

version: 2.2.24+

Query= NODE_2160645-0;57

Length=82

Sequences producing significant alignments: Score(Bits) EValue

ref|XP_002833304.1| PREDICTED: hypothetical protein LOC100444373... 37.7 0.74

ref|XP_002833304.1| PREDICTED: hypothetical protein LOC100444373 [Pongo abelii]

Length=134

Score = 37.7 bits (86), Expect = 0.74

Identities = 11/14 (78%), Positives = 14/14 (100%), Gaps = 0/14 (0%)

Frame = -1

Query  82   WNGLEWNGLNGMDW  41

            WNG++WNG+NGMDW

Sbjct  100  WNGIQWNGMNGMDW  113

Lambda K H

0.318 0.134 0.401

Gapped

Lambda K H

0.267 0.0410 0.140

Effective search space used: 152859517525

Subject length (134) is given in amino acids, not nucleotide, because it is an amino acid database. The length of the alignment is 14 out of 134 aa.

Log in to answer this question.