This is a test version of Biostars. For the public version, visit https://www.biostars.org.
single cell INDEX & Seq

Hi everybody

The Genomic unit provided me info related to a single cell RNA seq I have to analyse. They wrote the sample ID, for each sample they wrote the index and an other info that is "Seq" (a list of 32 genomic-basis letters). In which step of the analysis should I consider the "Seq" information? What is Seq?

single cell rna-seq
• 1,725 views • link
written by GiuliaAC • GiuliaAC

As described this is not making a lot of sense.

"Seq" (a list of 32 genomic-basis letters)

What does this mean? Is there only one Seq per sample ID? Is this 10x genomics data?

• 0 views • link
written by GenoMax GenoMax

10x data

transcriptomic data

single cell RNA sequencing

sample 1 --> 1 ID --> 1 index --> 1 Seq (eg: GTAATTGCAGTCGCTTCACGAGAATCGTCACG)

sample 2 --> 1 ID --> 1 index --> 1 Seq

Of course all IDs, indexes and "Seq" are different

• 0 views • link
written by GiuliaAC • GiuliaAC

Does Index sequence (or is that a code like SI-GA-A01) match first 8 basepairs from Seq?

My speculation is that Seq is actually a concatenation of 4 individual Illumina indexes that are used to label each sample in 10x technology. SI-GA-A01 code used by 10x points to those 4 individual Illumina indexes. You can find a spreadsheet with the codes and sequences on 10x support site.

• 0 views • link
written by GenoMax GenoMax

The index is written like the code you reported So, should seq be the sequence of the index?

• 0 views • link
written by GiuliaAC • GiuliaAC

More than likely. Confirm for yourself here.

• 0 views • link
written by GenoMax GenoMax

0 answers

No answers yet.

Log in to answer this question.

More posts like this