single cell INDEX & Seq
Hi everybody
The Genomic unit provided me info related to a single cell RNA seq I have to analyse. They wrote the sample ID, for each sample they wrote the index and an other info that is "Seq" (a list of 32 genomic-basis letters). In which step of the analysis should I consider the "Seq" information? What is Seq?
• 1,725 views
•
link
0 answers
No answers yet.
Log in to answer this question.
As described this is not making a lot of sense.
What does this mean? Is there only one
Seqper sample ID? Is this 10x genomics data?10x data
transcriptomic data
single cell RNA sequencing
sample 1 --> 1 ID --> 1 index --> 1 Seq (eg: GTAATTGCAGTCGCTTCACGAGAATCGTCACG)
sample 2 --> 1 ID --> 1 index --> 1 Seq
Of course all IDs, indexes and "Seq" are different
Does Index sequence (or is that a code like
SI-GA-A01) match first 8 basepairs fromSeq?My speculation is that
Seqis actually a concatenation of 4 individual Illumina indexes that are used to label each sample in 10x technology.SI-GA-A01code used by 10x points to those 4 individual Illumina indexes. You can find a spreadsheet with the codes and sequences on 10x support site.The index is written like the code you reported So, should seq be the sequence of the index?
More than likely. Confirm for yourself here.