More posts like this
-
Refflat file for Rattus norvegicus
written by AIMAR •Hi everyone, hope everyone is doing well Is there anyone here who can help me to obtain the refFlat file for the Rat (Rattus norvegicus). …
-
ChIP-seq gene blacklist for Rattus norvegicus
written by Thomas •Hello, I am doing analysis on a ChIP-seq dataset from a cell line derived from Rattus norvegicus. I have seen lists of blacklisted regions in …
-
Getting all the X associated genes of an organism
written by Uri •Hi, Lets say I want to find all the synapse-associated genes of some organism (in my case Rattus norvegicus) to check what happened to them …
-
vcf file download
written by Hriday •I want to download dbSNP vcf file (version 155) where allele frequency (AF) for all the listed sites are present in the INFO field of …
-
liftover not giving same number of columns
written by GK1610I have a WGS file of 200 individuals. The file was aligned using hg19. I want to run liftover to change the coordinates to hg38 …
-
2/50 inidividuals show missing data at almost all positions in final vcf generated using HaplotypeC…
written by shreyasibiswas88 •Hello all, I used HaplotypeCaller from GATK to generate VCF from 50 individuals. My reference is Rattus norvegicus and 48/50 individuals are Rattus norvegicus. The …
-
How many gene transcripts are there in Rat genome (latest assembly)?
written by natarajan.padmaja •I am working on an RNA-Seq project with sequencing data from Rat samples. I would appreciate some help with obtaining the latest list of Rat …
-
bioperl fasta indexing problem with non model genome sequence
written by shreyasibiswas88 •Hello all, I am new to using bioperl and trying to extract the mRNA transcript for every gene from a reference fasta and gff file. …
-
Bowtie Outputs Hits That Are Shorter Than The Reads Aligned
written by Click downvote<p>I have a file that looks like</p> <blockquote> <p>>rno-miR-322 MIMAT0001619 Rattus norvegicus miR-322 </p> <p>CAGCAGCAAUUCAUGUUUUGGA </p> <p>>rno-miR-322* MIMAT0000547 Rattus norvegicus miR-322*</p> <p>AAACAUGAAGCGCUGCAACA</p> </blockquote> <p>The reads …
-
Where To Find A Good Estimate Of The Background Mutation Rate In Rattus Norvegicus
written by Rubal<p>Hello everyone,</p> <p>I am trying to find a good estimate of the average and preferably also the upper and lower bounds of the mutation rate …
From Ensembl.
gvfformat here.