How to make a gene list among a specific QTLs region

Hi~ everyone

After I identified a sequence region from QTLs analysis, and I would like to know how many gene in this region and what kind of gene here. May someone give me some suggestions for this purpose?

Thank you very much

gene sequence

• 543 views • link

written 6.1 years ago by r00628112 •

0 answers

No answers yet.

More posts like this

How to extract sequence in fasta format from micro RNA gff3 files (sRNAanno database)?
written 3.6 years ago by r00628112 •

Dear all, I would like use the bulk miRNA data to do small RNA annotation, but sRNAanno database used gff3 format to storage sRNA information, …
About Fasta rename
written 5.7 years ago by r00628112 •

Hello everyone! For questions about using the dictionary. I would like to change the names of the sequences in the fasta file. I previously created …
About RefSeq Accession Number trasformation
written 6.1 years ago by r00628112 •

May anyone gives me some suggestions? I would like to modify a file in transforming the gene_id into protein_id based on this conversion table. Thank …
Virus Multilocus Sequence Analysis(MLSA)
written 6.1 years ago by Salsabil •

Hi everyone. This is my first time working on a Multilocus sequence Analysis for a virus. Usually, this technique is based on housekeeping genes in …
The genotype imputation in Beagle always stop on specific step and can not finish the imputation fi…
written 6.5 years ago by r00628112 •

Hello~ About the genotype imputation in Beagle, I run the vcf file, but the program always stopped in this step as the attached link.(https://drive.google.com/open?id=1osAetLl0rSG9FlfvnAwlEp3dZm-ZFVc6) I …
How can I use rdp classifier method when use pick_open_reference_otus.py
written 9.2 years ago by bioxujintian •

Hi, Everyone I am new in use Qiime software to analysis 16S-sequencing data. When I use pick_open_reference_otus.py and want to use rdp classifier method to …
How to fill the gaps in the genome by using CLCgenomeworkbench?
written 9.9 years ago by k.kathirvel93

Hi Everyone, I am working in the bacterial genome, and Am doing Denovo assembly using CLC. After developing a scaffold from CLC there were some …
Perl script: generate pseudo-CDSs from intergenic region
written 11.7 years ago by biolab

Hi everyone Recently I read a paper (Genetica (2009) 137:159-164), in which the authors generate pseudo-CDSs (in other words, negative dataset) based on intergenic sequences. …
Multi-Sequence Alignment For Many Groups Of Genes
written 12.6 years ago by biolab

<p>Dear all, How to make muli-sequence alingment for many groups of genes? I make an example here.</p> <pre><code>>gene1_human ATTTGCGTGACTGACTGC >Gene2_human GCGCGCATGATCCGATGACTG >gene3_human TGATACGATGCTGACTGACTGAC ...... >gene1_fly …
How To Carry Out Dfr Sliding Window Analysis?
written 16.2 years ago by Cheng Zhongshan

<p>Hi, dear members, I want to use DFR sliding window analysis to compute total T scores and differential scores per million base pairs from neighboring …