I am trying to retrieve geodata sets "GSE146049" through the following commands: ```r #Creation of object(folder) exdir exdir <- path.expand("~/GSE146049_RAW") dir.create(exdir, showWarnings = FALSE) URL …

Dear all, I am meaning to compare a couple of assemblies with a reference. I find ACT great for visualizing this sort of analyses but …

I'm trying to install blast locally on my computer (running Ubuntu 20.04 on Windows 10 WSL). Blast was installed in my C drive (as the …

hi everyone! i am using blast+ to make db, but i one error command line: ncbi-blast-2.10.1+/bin/makeblastdb -in plasmid_refseq.fasta -dbtype nucl -parse_s error: Keep MBits: T …

I am trying to do blastp for a research project this is my code: >`$ makeblastdb -in refseqlassa.fasta -parse_seqids -out lassadbv2 -dbtype prot` After I …

I tried to create blast database for my fasta file: >ban-mir-276 agcgagguauagaguuccuacguaauacaugccuguaggaacuucauaccgugcucu >ban-mir-9a ucuuugguuaucuagcuguaugaguacucagacaucauaaagcuagguuaccggaguua >ban-bantam cugguuuucauaaugauuugacagauuguuccauauucugagaucauugugaaagcugau >ban-mir-279b aagggguuuaaaucuaguagcacaguguucaccugugacuagaucuacacucauuga using command: makeblastdb -in hairpin_name.fa -dbtype nucl …

Hello, I am trying to generate comparison files (crunch files) to view in ACT. I am using the example code below in the terminal: makeblastdb …

CI am trying to visualize the differences in the genome of an evolved strain of *Bacillus subtilis* and have attempted using numerous methods including mauve, …

Hi, I installed the sratoolkit from NCBI by following. While running prefetch, the following error generated. I assume something wrong with my path. How can …

**Objective: to convert vcf to bed** **Tool used: [bedops][1]** **Command:** /home/bedops/bin/convert2bed -i vcf < my.vcf > my.bed **Error encountered** Error: Could not allocate space for …