This is a test version of Biostars. For the public version, visit https://www.biostars.org.
question regarding splitting fa file with fasplit

Hello everyone,

I used fasplit to separate my fasta file into two parts, it works fine but some part got dropped.

the code I use faSplit sequence 'myfile' file-number-required 'output_filename'

format in my original fasta file. that of my division files

somehow the gene ID got cut off when the software gonna recognize the sequence boundaries and execute splitting function.

Should I revise the format of my original file which makes the boundaries beyond my gene ID so that it wont be lost? and how?

appreciate any help!

fasplit

Please see How to add images to a Biostars post to add your images properly. You need the direct link to the image, not the link to the webpage that has the image embedded (which is what you have used here)

ya, sorry, I've corrected it. thanks a lot.

Many programs ignore things after first white space in fasta header. See if you can pass the entire header in " to faSplit and see if that helps. Otherwise you will need to change the spaces to _ to make the headers unique.

there is no need to add an image, the content of your shell is text, highlight the text then paste it into the box, and select "code" formatting, like so:

cat foo.fa

prints:

>foo bar baz
TTAGGAGGAACACCAGTGGCGAAAGCGGCTTACTGGACTGTAAC

thank you for the advice:)

1 answer

Use a different tool, for example seqkit

you can split files by id with:

seqkit split -i foo.fa

thank you, it works!

Log in to answer this question.