Hey, guys. How are you doing?!

I am analysing a RNAseq. First of all I am doing a pre processing of the reads using fastx toolkit.

time fastq_quality_filter -v -q 20 -p 70 -Q33 -i sample.fastq -o sample_quality_filtered.fastq

and

time fastx_clipper -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -v -Q33 -l 50 -i sample_quality_filtered.fastq -o sample_clipped.fastq

And then the mapping:

time STAR --runThreadN 4 --genomeDir --readFilesIn sample_R1.fastq.gz sample_R2.fastq.gz --sjdbGTFfile --outFilterMultimapNmax 20 --outFileNamePrefix --outSAMtype BAM SortedByCoordinate --quantMode GeneCounts --readFilesCommand gunzip -c

It's a paired-end data. Curiosly, when I map the reads using STAR aligner, I get this error: EXITING because of FATAL ERROR in reads input: short read sequence line: 0. But if I map the pairs separately or if I map them without pre processing I do not get the error.

I think that, for some reason, when I trim the data I am deleting one of the pairs, them the aligner can not find the pairs of some reads and I get the error.

Do you think this is the problem?

Any suggestion for processing to avoid this error?

Thank you, guys