script to print fasta file
Hi,
i have fasta files which look like this
>CATGTAGTGATTGATAGTGATA(1)
CATGTAGTGATTGATAGTGATA
>ATCCGTGAGCTTGAAGGATCCGCC(1)
ATCCGTGAGCTTGAAGGATCCGCC
>AAAACTACATATACATTCGGATT(2)
AAAACTACATATACATTCGGATT
>CCTGCATAGAGGATTCCGAAC(1)
CCTGCATAGAGGATTCCGAAC
>CATGAACAAGATGTTTGAGAACT(1)
CATGAACAAGATGTTTGAGAACT
I need to edit the header for each sequence and along with it print the sequences based on the abundance with unique header sequence
can someone kindly help me with this
How do i do this either in linux or shell scripting
Thank you!
• 1,551 views
•
link
written
by
ravi.eshwari •
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Writing lengths of fasta sequences to another file
written by Hau •
-
Extract sequence from Fasta using header
written by Princy •
-
convert .txt file to fasta format
written by ravi.eshwari •
-
Editing header of a fasta file
written by DVR •
-
Tool: Retrieve a subset of FASTA from large Illumina multi-FASTA file
written by hcwang •
-
Reading colon delimited description from Fasta file possible?
written by bfeeny •
-
Build Graph lost k-mers
written by lardo •
-
Frequency of a unique sequence in a fasta file
written by Tanvir Ahamed
-
Modifying A Gene Sequence With Personal Snps?
written by Chris Miller
-
Perl Print Nextline From Within While Loop?
written by User 3739 •
And what have you tried so far?
i used the following command
it did change the header sequence but i now need to also print the sequence with more than one abundance with unique header
Please provide an example of the output you would expect - your question is unanswerable at the moment.
Edit it how? What abundance?
In addition: Technically the posted example qualifies for fasta format but having sequence repeated in the header is not going to make this easy to decipher.