This is a test version of Biostars. For the public version, visit https://www.biostars.org.
script to print fasta file

Hi,

i have fasta files which look like this

>CATGTAGTGATTGATAGTGATA(1)
CATGTAGTGATTGATAGTGATA
>ATCCGTGAGCTTGAAGGATCCGCC(1)
ATCCGTGAGCTTGAAGGATCCGCC
>AAAACTACATATACATTCGGATT(2)
AAAACTACATATACATTCGGATT
>CCTGCATAGAGGATTCCGAAC(1)
CCTGCATAGAGGATTCCGAAC
>CATGAACAAGATGTTTGAGAACT(1)
CATGAACAAGATGTTTGAGAACT

I need to edit the header for each sequence and along with it print the sequences based on the abundance with unique header sequence

can someone kindly help me with this

How do i do this either in linux or shell scripting

Thank you!

sequence fasta

And what have you tried so far?

i used the following command

awk '/^>/{print ">seq1" ++i; next}{print}' < SRR1266859.fa > SRR1266859.new.fa

it did change the header sequence but i now need to also print the sequence with more than one abundance with unique header

Please provide an example of the output you would expect - your question is unanswerable at the moment.

Edit it how? What abundance?

In addition: Technically the posted example qualifies for fasta format but having sequence repeated in the header is not going to make this easy to decipher.

0 answers

No answers yet.

Log in to answer this question.