Extract sequence from Fasta using header
Hello, I have a list of headers, I need to extract the sequence from the fasta file. how can I do it? kindly let me know.
The header file looks like this
>TRINITY_DN74691_c0_g1_i1
>TRINITY_DN74659_c0_g1_i1
>TRINITY_DN74659_c0_g1_i1
>TRINITY_DN74698_c0_g1_i1
fasta file looks like this
>TRINITY_DN74697_c0_g1_i1 len=243 path=[221:0-242] [-1, 221, -2]
GTATGTCCCACCAGACACAGCAGGGCTGGCAGGCCGAGTTTGAGTTTGGAATATATCTG
2 answers
seqkit will be able to do this. (subprogram seq )
(alternative, if you have a blastdb of that fasta file, you can also get them by using blastdbcmd)
• 0 views
•
link
written
by
lieven.sterck
Log in to answer this question.
More posts like this
-
Edit fasta header for TSA submission
written by sumitra.20 •
-
Extract header from fasta file
written by Princy •
-
need to remove some part of header fasta file
written by Princy •
-
Is there a way to change only the header of a fasta file?
written by Riku •
-
Extract sequences from a list of ID
written by doinelpierrot •
-
Extracting fasta sequence from CDS matching with sequence ID
written by metallicasster •
-
Edit a Multifasta File Through awk
written by pthom010 •
-
parse of file multifasta in python
written by erick_rc93 •
-
extract fasta sequence using fasta header with python 3
written by ddowlin
-
FASTA sequence extraction using list of sequence name that are not identical with the headers?
written by seta
@princy: You have asked many questions on biostars over the last few months but appear not to have validated any of them. Accepting answers (you can accept multiple) using the
green checkmarkis appropriate way to provide closure to threads.