This is a test version of Biostars. For the public version, visit https://www.biostars.org.
BAM file output

Hi, I need help to know the contents of my bam file. I read this bam file but couldnt understand the abbreviations present in it. Please help me with this.

7001448:359:C7F6GANXX:8:1207:19447:91866        83      0       21998248        60      126M    0       21998124        126     GGACAGCACTGGGAGCGTGAGGCTGCTGTGCGCTTCCAGCATGTGGGCACCTCTGTGTTCCTGTCAGTCACGGGTGAGCAGTATGGAAGCCCCATCCGTGGGCAGCATGAGGTCCACGGCATGCCC  array('B', [33, 30, 29, 33, 33, 29, 40, 33, 38, 35, 36, 36, 38, 36, 38, 33, 38, 35, 38, 37, 33, 29, 38, 35, 38, 38, 35, 39, 35, 38, 34, 38, 38, 36, 34, 37, 40, 37, 38, 40, 31, 36, 38, 35, 36, 36, 38, 40, 33, 37, 38, 30, 38, 35, 39, 35, 38, 34, 34, 37, 35, 35, 39, 34, 37, 36, 38, 32, 40, 34, 34, 36, 36, 38, 35, 38, 36, 38, 40, 36, 38, 32, 34, 35, 36, 37, 34, 33, 38, 37, 37, 38, 41, 34, 34, 37, 34, 38, 35, 36, 36, 37, 40, 36, 38, 37, 34, 35, 38, 34, 36, 38, 34, 37, 40, 33, 34, 35, 37, 40, 32, 33, 33, 32, 33, 32])    [('MC', '126M'), ('BD', 'OONONNNOOOLOONONNNONNOOOOONNOONONOONONNONNNOLNNNNOOOONNNNOOOONNNONNNNNNLNNNONNONONNOONNNNLLNOOONNNOLNNONNONNONNNONNNNNNONONLNN'), ('MD', '126'), ('PG', 'MarkDuplicates.Q'), ('RG', 'tumor'), ('BI', 'RRSTSSTSSSQRRTSSTTRSSTSSTSSTSSSTRSTTTTSTTSTSQSSTTQSRSSTSRSTQSSSTTSSTTSSQSTTRTSTSSSTSRSSTSQQTTSTSSTSQSSTTSTTTRSSSTTTSSSSTTSSQSS'), ('NM', 0), ('MQ', 60), ('AS', 126), ('XS', 19)]
next-gen genome

2 answers

Read the SAM/BAM specification document.

I got that, but what about the array mentioned in this named 'B' ??

It would appear that whatever the tool you've used to display the contents is, it's rather unusually chosen to write out the individual base qualities numerically — instead of the SAM file's native QUAL field, an ASCII-encoded string of base qualities.

I got that, but what about the array mentioned in this named 'B' ??

Log in to answer this question.