This is a test version of Biostars. For the public version, visit https://www.biostars.org.
ncbi fasta files

I have been trying to download a fasta file from NCBI with the code below:

wget https://www.ncbi.nlm.nih.gov/nuccore/NG_049243.1?report=fasta

but what I get is all the html index. I have tried with efetch but as I do not have sudo right on the server to install it. Is there any suggestion to improve the command line so I can get a nice fasta format file.I have also tried with curl but I got the same html index. The above script seems to work with everyone except me.

sequence
• 8,577 views • link
updated by Pierre Lindenbaum Pierre Lindenbaum • written by bio90029 • bio90029

Do you need to use an HTTP proxy to access the internet? If so, you'll need to set your $HTTP_PROXY and $HTTPS_PROXY environment variables appropriately: https://askubuntu.com/a/584150

• 0 views • link
written by Matt Shirley Matt Shirley

Unluckily, I have not sudo right on this server as it is set up by work. I will have to ask for sudo right or them to set it up.

• 0 views • link
written by bio90029 • bio90029

Try conda for installing Entrez Direct utilities https://anaconda.org/bioconda/entrez-direct which does not require root permissions.

I doubt this code above works for anyone as it is not the path to a file directly. This fasta is small enough for copy/pasting though.

• 0 views • link
written by ATpoint ATpoint

Thanks. But as I stated I have sudo right so I cannot install anything on the server. Although, I will try it with my home computer.

• 0 views • link
written by bio90029 • bio90029

It does not require any root permissions, though the answer of Pierre Lindenbaum below is the easiest way to go.

• 0 views • link
written by ATpoint ATpoint

1 answer

I have tried with efetch but as I do not have sudo right on the server to install it.

if you have wget, you can use the NCBI efetch service.

$ wget -q -O - "https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&id=NG_049243.1&rettype=fasta"
>NG_049243.1 Acinetobacter baumannii C1AC9-24 blaKPC gene for carbapenem-hydrolyzing class A beta-lactamase KPC-10, complete CDS
ATGTCACTGTATCGCCGTCTAGTTCTGCTGTCTTGTCTCTCATGGCCGCTGGCTGGCTTTTCTGCCACCG
CGCTGACCAACCTCGTCGCGGAACCATTCGCTAAACTCGAACAGGACTTTGGCGGCTCCATCGGTGTGTA
CGCGATGGATACCGGCTCAGGCGCAACTGTAAGTTACCGCGCTGAGGAGCGCTTCCCACTGTGCAGCTCA
TTCAAGGGCTTTCTTGCTGCCGCTGTGCTGGCTCGCAGCCAGCAGCAGGCCGGCTTGCTGGACACACCCA
(...)
• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

Fantastic! it did work.Thanks a lot.

• 0 views • link
written by bio90029 • bio90029

Log in to answer this question.

More posts like this