This is a test version of Biostars. For the public version, visit https://www.biostars.org.
issue for doing an small rna seq analyzing

Hello and merry Christmas

I having trouble for doing an small RNA-seq analyzing So, i align my data with rRNA reference which i downloaded from BioMART.(with Bowtie2) and then took the unaligned reads and map them to my hairpin reference which i downloaded from MirBase(with Bowtie2) and finally get the counts with featureCount(enabled to do not discard multimappers). but at the end i have zero count for DEG step. what should i do ?

rna-seq
• 2,125 views • link
updated by Biostar Biostar • written by sabaghianamir70 • sabaghianamir70

my hairpin reference which i downloaded from MirBase

Did you convert U bases to T before creating your bowtie2 index?

>cel-let-7 MI0000001 Caenorhabditis elegans let-7 stem-loop
UACACUGUGGAUCCGGUGAGGUAGUAGGUUGUAUAGUUUGGAAUAUUACCACCGGUGAAC
UAUGCAAUUUUCUACCUUACCGGAGACAGAACUCUUCGA
>cel-lin-4 MI0000002 Caenorhabditis elegans lin-4 stem-loop
AUGCUUCCGGCCUGUUCCCUGAGACCUCAAGUGUGAGUGUACUAUUGAUGCUUCACACCU
GGGCUCUCCGGGUACCAGGACGGUUUGAGCAGAU

With smallRNA you may want to use bowtie v.1.x since you want ungapped alignments with your short reads.

• 0 views • link
written by GenoMax GenoMax

Thanks, I am converting them right now, A side question, So i didnt use Mature MiRNA anywhere. Where we should use mature mirna /?

• 0 views • link
written by sabaghianamir70 • sabaghianamir70

Im using bowtie2, also i can use RNA STAR(which is not preferable), and Hisat2. i cant use bowtie v1. is there any other tool which i can use ? in Bowtie2, i did convert to RNA but still no result.

• 0 views • link
written by sabaghianamir70 • sabaghianamir70

As always in technical debugging question, provide command lines please. Words alone are not sufficient. If you have no results at all odds are good that it is a problem with adequate tool usage but not a problem with the tools itself.

• 0 views • link
written by ATpoint ATpoint

I'm a little confused by why you don't simply align your reads to the entire genome and then use the annotated miRNA locations for your analysis? This should take care of your rRNA reads in addition to the added benefit of removing other small RNA that are derived from the genome (e.g. tRNA, snoRNA, piRNA, etc...); which might otherwise map aberrantly to the hairpins.

• 0 views • link
written by benformatics benformatics

I did that said, it seems everything is fine, So @ATpoint and @genomax, Do you approve this method ?

• 0 views • link
written by sabaghianamir70 • sabaghianamir70

0 answers

No answers yet.

Log in to answer this question.

More posts like this