You can also use MEME: http://meme.sdsc.edu/.

Some time ago I used SOMBRERO with a good degree of success on finding motifs in a very diverse set of sequences. They have a Mac version for download as well as parallel versions for Irix and Linux.

The first step when looking for conservation of single bases or motives is often a multiple sequence alignment that will align the sequences in a way such that conserved regions are best visible. This can be a first step before using explicit motif finders like MEME. A good way of visualizing multiple alignments is the sequence-logo that will give a graphical representation of base conservation.

Here is the wikipedia list of multiple-sequence alignment tools.

I recommend to start with the EBI web-server of ClustalW though, if that is not enough you can also try MAFFT or T-Coffee.

Weblogo can generate sequence-logo graphics from the output and also from fasta input directly.

Advantage of these tools is that you don't need to install them, so good for a first attempt irrespective of using a Mac.

Meme has been the first program to be published for doing that.

As an alternative you can find one of the EMBOSS tools; if you are scared by a terminal and want to do it from a web-based interface, you can use the EMBOSS tools from galaxy

You may check out these pages:

• Bioinfo tutorial (Promoter prediction)
• Wikiomics:Sequence_motifs

These are ca 2 years old (links may not work etc.) but as a starting point should be OK. Also in unlikely case you did not found it yet: in yeast there has been an extensive motif search study done by Kellis with insane number of citations:

• Nature. 2003 May 15;423(6937):241-54.
• Kellis M, Patterson N, Endrizzi M, Birren B, Lander ES. Sequencing and comparison of yeast species to identify genes and regulatory elements

Try this out? http://fraenkel.mit.edu/webmotifs/form.html

ACGGGCCCGACGATGCGTCGTA
ACGTACGTCGAACCGTCGTCGT
ACGTGCGTCGAAACGTCAGTCG
ACGGGTTCGATCGTCGTCGTCG

may be in Python I will break down the first sequence of required motif length into a sliding window and will search for those list of motifs in the rest of sequences using regular expression in python using re.search() method.

I would recommend to use MEME.