This is a test version of Biostars. For the public version, visit https://www.biostars.org.
why is there "." in Filter?

This was the command I used sudo ./gatk HaplotypeCaller -R /home/arshiya/efs/FastQC/hg38.fa -I /home/arshiya/efs/FastQC/sample_sort_reads.bam -O /home/arshiya/efs/FastQC/sample_haplo.vcf.gz and the following was the output I got

chr1    7820343 .   A   AATCCATGAAATGGCATACGATCAACTAATGTGACTGTATAATCTTGTGGTAAAGAAGTAGT  121.84  .   AC=2    AF=1.00 AN=2    DP=3    ExcessHet=3.0103    FS=0.000    MLEAC=1 MLEAF=0.500 MQ=48.00    QD=25.36    SOR=2.833   GT:AD:DP:GQ:PL  1/1:0   3:3:9:135   9   0
chr1    11979551    .   TGA T   78.28   .   AC=2    AF=1.00 AN=2    DP=2    ExcessHet=3.0103    FS=0.000    MLEAC=1 MLEAF=0.500 MQ=40.00    QD=28.73    SOR=2.303   GT:AD:DP:GQ:PL  1/1:0   2:2:6:90    6   0
chr1    11979558    .   G   GCCTCCACAAATTGTTAATCCCGGCATACCATCTTCAATCGCTTC   78.32   .   AC=2    AF=1.00 AN=2    DP=2    ExcessHet=3.0103    FS=0.000    MLEAC=1 MLEAF=0.500 MQ=40.00    QD=30.97    SOR=2.303   GT:AD:DP:GQ:PL  1/1:0   2:2:6:90    6   0
next-gen
• 1,399 views • link
updated by benformatics benformatics • written by arshiya.g02 • arshiya.g02

1 answer

You need to apply a filter...?

Did you read the GATK manual and follow the best practices?

• 0 views • link
written by benformatics benformatics

yes I went through the manual and how to apply filter?

• 0 views • link
written by arshiya.g02 • arshiya.g02

Log in to answer this question.

More posts like this
  • Expanding gVCF box from GATK
    written by Axzd • Axzd
    Hello, I wanted to expand the gVCF block of my vcf but I got this as a result ##bcftools_convertCommand=convert --gvcf2vcf -f Adineta_vaga.fsa; Date=Tue Aug 1 …
  • why CombineGCVFs in gatk not showing all the samples name?
    written by rj.rezwan • rj.rezwan
    Hi, I combined the 64 `.vcf` files using the `CombineGVCFs` in `gatk`. The command was completed successfully but its showing the output with only one …
  • HaplotypeCaller GENOTYPE GIVEN ALLELES doesn't genotype given alleles
    written by kamanovae • kamanovae
    Hi! I am trying to run the Gatk HaplotypeCaller (human data): ``` ./gatk-4.1.2.0/gatk HaplotypeCaller\ --reference ref.fa \ --input file.bam \ --genotyping-mode GENOTYPE_GIVEN_ALLELES \ --alleles allele_chunk_file.vcf …
  • How is allelle frequency calculated ?
    written by DareDevil DareDevil
    How is allelle frequency calculated ? This a variation where Allelle Frequency (AF) is 0.500 and AD = 57,36 and DP = 93 My understanding …
  • Strange Allele Frequency in vcf file
    written by GP_PG • GP_PG
    Hi everyone. I performed a snp calling using GATK and following all the suggestions in the BestPractices sections. I performed single snp calling for two …
  • Diploid calls on chrY?
    written by dec986 dec986
    Hello, I recently got my genome sequenced. chrY 59030922 . A G 1244.77 PASS AC=1;AF=0.500;AN=2;BaseQRankSum=-6.580e-01;ClippingRankSum=0.00;DP=41;ExcessHet=3.0103;FS=9.230;MLEAC=1;MLEAF=0.500;MQ=37.33;MQRankSum=-4.563e+00;QD=30.36;ReadPosRankSum=-7.570e-01;SOR=0.076;VQSLOD=0.452;culprit=FS GT:AD:DP:GQ:PL 0/1:9,32:41:99:1273,0,180 chrY 59032665 . A G 418.77 PASS AC=1;AF=0.500;AN=2;BaseQRankSum=-4.182e+00;ClippingRankSum=0.00;DP=52;ExcessHet=3.0103;FS=0.000;MLEAC=1;MLEAF=0.500;MQ=45.59;MQRankSum=-6.082e+00;QD=8.21;ReadPosRankSum=-1.528e+00;SOR=0.756;VQSLOD=2.78;culprit=DP …
  • Debugging a sed script to extract values from rows in .txt file
    written by kristina.mahan kristina.mahan
    I am trying to extract out all the values for a specific quality filter MQRankSum. Someone has given a sed script showing how they did …
  • Annovar result explanation
    written by anu014 anu014
    Hello Biostars, I was trying to annotate the VCF using ANNOVAR. I used "table_annovar.pl" script to get these 2 files : myanno.hg19_multianno.txt & myanno.hg19_multianno.vcf. Firstly, …
  • Filtering out the variants annotated as "FILTER" from vcf file using GATK
    written by lakhujanivijay lakhujanivijay
    Hi, I am using GATK to filter out variants (specifically SNP's) based on mapping quality For tagging the variants which failed the MQ(mapping quality) filter, …
  • Large VCF QUAL Values
    written by pld pld
    I'm currently working on calling variants for a virus that was sequenced. For lack of a better solution, I'm using the GATK UnifiedGenotyper pipeline. I'm …