This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to reshape a fasta file?

Hello,

I've got some sequences shaped as

>Sj-D-P_M0276n4:119:000000000-C5R9K:1:1106n:1548n9:8n8n42 1:N:0:7
CTCAGAGCCAGGGTGCCACAGGTAAGAGTTACCTAAACTCAACATCCACGCTCTTTTTTGACCGCATGTC
TGAAACTTGAAGGAATTCCACCATTGCTTGTAGTCATCCTGAGTCAAATTTGCAGTTGTCTCACCACATG
TATGACCACCAGAGCCCTGGCCCTTCTCCATGTCCCGTGCATACCGCACGCCTCGCCGCTATTACCGTGC
CGAGCCACCGCTGTCCCGATCGAGTCTCAAGGGCCGCAAACCCACACCACTCAACCCCTGCTGCAAGGTG
AGGACCCGCAACTCGCTGT

I would like to remove the back to lines in the sequences (but not in the names) like: 

>Sj-D-P_M0276n4:119:000000000-C5R9K:1:1106n:1548n9:8n8n42 1:N:0:7    
CTCAGAGCCAGGGTGCCACAGGTAAGAGTTACCTAAACTCAACATCCACGCTCTTTTTTGACCGCATGTCTGAAACTTGAAGGAATTCCACCATTGCTTGTAGTCATCCTGAGTCAAATTTGCAGTTGTCTCACCACATGTATGACCACCAGAGCCCTGGCCCTTCTCCATGTCCCGTGCATACCGCACGCCTCGCCGCTATTACCGTGCCGAGCCACCGCTGTCCCGATCGAGTCTCAAGGGCCGCAAACCCACACCACTCAACCCCTGCTGCAAGGTGAGGACCCGCAACTCGCTGT

How to proceed?

Thanks in advance

fasta dna
• 1,652 views • link
updated by JC JC • written by gbl1 gbl1

have you looked around for a (possible) solution? This has been covered several times before. try googling on something like "reformat fasta file to single line", that will give you numerous options.

one of the results will be Multiline Fasta To Single Line Fasta for instance.

• 0 views • link
written by lieven.sterck lieven.sterck

The keyword you’re looking for here is likely “linearising fasta”

• 0 views • link
written by Joe Joe

Thanks :)

I had looked for "reshape fasta" nothing out… Well, a non-native issue

• 0 views • link
written by gbl1 gbl1

1 answer

perl -pe 's/\n// unless (/>/)' < FASTA > LINEARFASTA

• 0 views • link
written by JC JC

Log in to answer this question.

More posts like this
  • How to convert amino acid sequence to numbers
    written by nrizzolo1796 • nrizzolo1796
    I have this file files = list(SeqIO.parse("proteasomes.fasta", "fasta")) Which is a list of proteasome Amino Acid sequences like "MALASVLERPLPVNQRGFFGLGGRADLLDLGPGSLSDGLSL..." I want to convert each letter …
  • overlap (semi global) end alignment for two fasta files
    written by madiha_shabbir46 • madiha_shabbir46
    Hi there, I need to find overlaps (semi global alignment) between ends of two strings (two fasta sequences), for that I tried edlib library for …
  • reliable way to trim
    written by gbl1 gbl1
    Hello, I realized that my data were not trimmed and I wish to get something out of them… I was advised "trimomatic" So, I tested, …
  • DNA Ancestral State Reconstruction in Phangorn (or similiar)
    written by jnf3769 • jnf3769
    Howdy Biostars, I have DNA sequence that I have successfully done a bunch of tree building for in BEAST2 to get a time calibrated tree …
  • Sorting out CD HiT output
    written by gbl1 gbl1
    Hi, I have a CD-hit output looking like this: > \## 73 MIXED Sb-40 4 6 66.66666666666667 cluster_stats(length_max=319, length_min=205, length_mean=296.6666666666667, length_variance=2042.2666666666667, length_stdev=45.19144461805428, length_members_max=317, length_members_min=205, length_members_mean=292.2, …
  • Replacing nth character in all lines help
    written by austinjyoder • austinjyoder
    So I've got a bunch of files like the picture shows. I need to remove the plus sign in between each set of 8 characters, …
  • Model matrix for limma voom
    written by ioannis • ioannis
    Hello community, I have a large data set called "DWsub". It looks like this: > head(DWsub, n=3) CDx CWx D53x D63x D66x D68x D70x D72x …
  • needleman-wunsch algorithm on python
    written by elisheva elisheva
    hello everyone. I have to execute the needleman-wunsch algorithm on python for global sequence alignment. I have to fill 1 matrix withe all the values …
  • searching reads with a certain sequence in fastq file
    written by sumithrasank75 sumithrasank75
    I have a file say master.fastq which looks like : ``` @M00990:202:000000000-ADM27:1:1101:21678:1536 2:N:0:291 CCTTTTACCGACCCGCTCTTTCTCTCCTACGCTTATTTCCGTCTACCCTTCTCTTCACTCGCTATTTCTATTCTTAAAACTATCTTAATGTTCTGCCTTTGCTCTTTTCTTTTTTCTATAACCTCTCTACAGCCAACTCACCCATCTCCTTCCCTGCTACGCTATTCCTCTGTTAGTTTTTCTTCATCATACTTTTCTCATCTCACACTACCTTTGCACTTCTTCCTTTCCACGTCCCCTTTCTCCTACC + -----,,6;6,@+8++6+,,,<C5@,,,,,,+8,,;,,<,,,,,,,;,,;,,,<C,,,;,,8,,8CC,C,,,5,C,,,,99,+,+4,,,3,,9,,6,@<,,,,,,,9,,,,,,,4),,0**,,5),,5**,)59*0),,*)5,)))*,9,3,0++))5D:)))))5;+;+0)*;+*6++++),******3**50,6,+++**,0*,,31)88*0*1*5*1)0*:*7>C;3,035:0)))8).*2**.*:) @M00990:202:000000000-ADM27:1:1101:22685:1539 2:N:0:291 CTTATCACCGACTCTCTCCTTCTCTTCCAAGTTTATTTCCGACTCCCCTTATCTTCACTTGCTATTTCTATTCTTAAAACTATCTCGACCTTTCACCTTTCCCTCTTTCCTTCTTTTCTCTCCTTCTACACTCCCACCCACTCTTACTTCTTTCTTGTCACCGTTTCCATATTATACTTTCTTCTCTTACATAATTTTCTTCCTGCAAACTATTTAAGCAATCTCTTTCTTTCACCCCTTTTATCTCGCC + -----,,<;67@+B,,6,,,,;C5@,,,,,66<,,6,,<,,,66,,;,66,,;;C,,,;,4<,,<CC6C,;,,,;,,6,:,6?A9=,,+++2,5,,,9<?D,,,,,:C?,@,@,,5,?*3*,9**,,0**,*)93))4+))19*0**,,52,56+**5*03*)3)))42+2***5*+=3+,*4*2****,**2*,3,+++*0,50,,**5*****0****)5)***0**,,***3*)0)))3***0*))) ``` I want only …
  • Why "No real operator (M|I|D|N)" in picard?
    written by dariober dariober
    Hello, Using picard [CollectAlignmentSummaryMetrics][1] I get the error `No real operator (M|I|D|N) in CIGAR`. I guess this happens when an operator other than M, I, …