Biostar Beta. Not for public use.
reliable way to trim
Entering edit mode
18 months ago
gbl1 • 70


I realized that my data were not trimmed and I wish to get something out of them… I was advised "trimomatic"

So, I tested, and obtained sequences like:

>M02764:119:000000000-C5R9K:1:1101:8653:1645 1:N:0:1


I could used "sed" but it would need a perfect match, and you know sequencers… often not reliable… Any advise?

radseq trimming • 257 views
Entering edit mode

How did you adapter end up in the middle of the read? :o

Entering edit mode

adapter was add by restriction/ligation

Illumina gives something with a full size primer (50 b) then there's that poly A and random bases

Entering edit mode

Can you show how you used trimomatic?

Entering edit mode
java -jar /Users/benjamin/Downloads/Trimmomatic-0.38/trimmomatic-0.38.jar PE -phred33 /Users/benjamin/Downloads/Leduc_PCR_MiSeq-20190221R/A001-Vs-04-P-GCTGAAGA-CAGATGTA-Leduc-run20190221R_S1_L001_R1_001.fastq.gz /Users/benjamin/Downloads/Leduc_PCR_MiSeq-20190221R/A001-Vs-04-P-GCTGAAGA-CAGATGTA-Leduc-run20190221R_S1_L001_R2_001.fastq.gz output_forward_unpaired.fq.gz output_reverse_paired.fq.gz output_reverse_unpaired.fq.gz ILLUMINACLIP:TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
Entering edit mode

ILLUMINACLIP:TruSeq3-PE.fa while you say your adaptor is `GGTGAGGACCTGCCGCAACTCGCTGT?

Entering edit mode
3 months ago
genomax 68k
United States

Use from BBMap suite. -Xmx2g in=your.fq.gz out=trim.fq.gz literal=GGTGAGGACCTGCCGCAACTCGCTGT ktrim=r k=21
Entering edit mode

Need assistence:

MachincBenjamin:Leduc_PCR_MiSeq-20190221R benjamin$ /Users/benjamin/Downloads/bbmap/ -Xmx2g in=/Users/benjamin/Downloads/Leduc_PCR_MiSeq-20190221R/A008-Sj-D-N-GCTGAAGA-CAGTTTGT-Leduc-run20190221R_S8_L001_R2_001.fastq.gz   out=trim.fa literal=GGTGAGGACCTGCCGCAACTCGCTGT ktrim=r k=21
java -ea -Xmx2g -Xms2g -cp /Users/benjamin/Downloads/bbmap/current/ jgi.BBDuk -Xmx2g in=/Users/benjamin/Downloads/Leduc_PCR_MiSeq-20190221R/A008-Sj-D-N-GCTGAAGA-CAGTTTGT-Leduc-run20190221R_S8_L001_R2_001.fastq.gz out=trim.fa literal=GGTGAGGACCTGCCGCAACTCGCTGT ktrim=r k=21
Exception in thread "main" java.lang.NoClassDefFoundError: java/util/concurrent/ThreadLocalRandom
    at jgi.BBDuk.<clinit>(
Caused by: java.lang.ClassNotFoundException: java.util.concurrent.ThreadLocalRandom
    at Method)
    at java.lang.ClassLoader.loadClass(
    at sun.misc.Launcher$AppClassLoader.loadClass(
    at java.lang.ClassLoader.loadClass(
    ... 1 more
Entering edit mode

After you uncompress the bbmap source don't move any of the folders below the top level folder. Add the folder to your $PATH.

If you have paired-end data then you need to do: -Xmx2g in1=your_R1.fq.gz in2=your_R2.fq.gz  out1=trim_R1.fq.gz out2=trim_R2.fq.gz  literal=GGTGAGGACCTGCCGCAACTCGCTGT ktrim=r k=21 tbo tpe

Do not trim paired-end reads independently. Otherwise read order would get messed up.

If you need the data converted to fasta format then do conversion after trimming. in=trimmed.fq.gz out=trimmed.fa
Entering edit mode

I guess there's something wrong:

MachincBenjamin:Leduc_PCR_MiSeq-20190221R benjamin$ -Xmx2g in1=A008-Sj-D-N-GCTGAAGA-CAGTTTGT-Leduc-run20190221R_S8_L001_R1_001.fastq.gz in2=A008-Sj-D-N-GCTGAAGA-CAGTTTGT-Leduc-run20190221R_S8_L001_R2_001.fastq.gz   literal=GGTGAGGACCTGCCGCAACTCGCTGT ktrim=r k=21 tbo tpe
java -ea -Xmx2g -Xms2g -cp /Users/benjamin/Code-source/bbmap/current/ jgi.BBDuk -Xmx2g in1=A008-Sj-D-N-GCTGAAGA-CAGTTTGT-Leduc-run20190221R_S8_L001_R1_001.fastq.gz in2=A008-Sj-D-N-GCTGAAGA-CAGTTTGT-Leduc-run20190221R_S8_L001_R2_001.fastq.gz literal=GGTGAGGACCTGCCGCAACTCGCTGT ktrim=r k=21 tbo tpe
Exception in thread "main" java.lang.NoClassDefFoundError: java/util/concurrent/ThreadLocalRandom
    at jgi.BBDuk.<clinit>(
Caused by: java.lang.ClassNotFoundException: java.util.concurrent.ThreadLocalRandom
    at Method)
    at java.lang.ClassLoader.loadClass(
    at sun.misc.Launcher$AppClassLoader.loadClass(
    at java.lang.ClassLoader.loadClass(
    ... 1 more
MachincBenjamin:Leduc_PCR_MiSeq-20190221R benjamin$ echo $PATH
Entering edit mode

What OS are you using? Are you using the latest java available for that OS?

Entering edit mode

I use OSX

MachincBenjamin:Leduc_PCR_MiSeq-20190221R benjamin$ java -version
java version "1.6.0_51"
Java(TM) SE Runtime Environment (build 1.6.0_51-b11-457)
Java HotSpot(TM) 64-Bit Server VM (build 20.51-b01-457, mixed mode)
Entering edit mode

Can you upgrade your java? I believe bbmap is only tested for Java 1.7 and up. I have Java 9.0.1 on a mac and that works fine.

Entering edit mode

Grrr… I tried, and it is still the same… Actually, the java that is used is in /usr/bin/ and the newer versions are after in the path… any idea how to get it out?

Entering edit mode

Can you directly run

/path_to_java_you_want/java -ea -Xmx2g -Xms2g -cp /Users/benjamin/Code-source/bbmap/current/ jgi.BBDuk -Xmx2g in1=A008-Sj-D-N-GCTGAAGA-CAGTTTGT-Leduc-run20190221R_S8_L001_R1_001.fastq.gz in2=A008-Sj-D-N-GCTGAAGA-CAGTTTGT-Leduc-run20190221R_S8_L001_R2_001.fastq.gz literal=GGTGAGGACCTGCCGCAACTCGCTGT ktrim=r k=21 tbo tpe
Entering edit mode

What are the parameter to play with in order to increase sensitivity for mismatches?

Entering edit mode

hdist=. Use a number to allow mismatches. Here is a guide for bbduk.

Entering edit mode


I actually get a small issue:


If there is a missing base in the sequence from illumina, it cannot be trimed… How to clean that?

Entering edit mode

You could use literal=CCGTGTGCGCCTCACCCCTG,GGTGAGGACCTGC in this specific case. Is hdist=1 or 2 not working?

Entering edit mode

No, hdist=1 or 2 is only working for mismatch, not for insertion/deletion

I showed just 2 exemples, but it might happen everywhere…

Entering edit mode

I added markup to your post for increased readability. You can do this by selecting the text and clicking the 101010 button. When you compose or edit a post that button is in your toolbar, see image below:

101010 Button


Login before adding your answer.

Similar Posts
Loading Similar Posts
Powered by the version 2.1