This is a test version of Biostars. For the public version, visit https://www.biostars.org.
What is the "-" option of samtools?

Hi all,

I saw a command line:

samtools view -u alignment.sam | samtools sort -@ 4 - output_prefix

from samtools (conversion from .sam to .bam) and sorting of .bam file

I don't know the function of the - before the output_prefix. I cannot find it in the manual book.

Could you help me figure out it?

Thank you!

samtools
• 2,672 views • link
updated by Pierre Lindenbaum Pierre Lindenbaum • written by vw • vw

1 answer

'-' just means stdin/standard input

http://www.htslib.org/doc/samtools-1.2.html

Samtools is designed to work on a stream. It regards an input file - as the standard input (stdin) and an output file - as the standard output (stdout).

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

Thank you! You solved my question.

• 0 views • link
written by vw • vw

Log in to answer this question.

More posts like this
  • using parallel on samtools view
    written by chictu • chictu
    I cannot get this to work. `>` seems to be the problem. but I can't figure out how to fix it. bam=bam_paths.txt id=samples_ids.txt parallel --xapply …
  • Read Classification from ONT
    written by maevalefeuvre • maevalefeuvre
    Good morning, I have multiple fastq.gz file generated using **ONT** and belonging to **one sample**. Each fastq.gz file is composed of many reads, and each …
  • How i can get unalignment read in hisat2 ?
    written by Ahmed • Ahmed
    is there any option in hisat2 for viewing unalignment read? first: i make index for my refrence genome with this command: hisat2-build -p 3 Danio_rerio.GRCz11.cdna.all.fa …
  • Filter out reads with hidden tags in bam files
    written by jkim • jkim
    Hello, I saw this post [https://www.biostars.org/p/476322][1]/ but I couldn't figure out how to filter out the reads having hidden tags (SA) - like the screen …
  • samtools extract unmapped reads
    written by wrab425 • wrab425
    I have been given the following command to extract unmapped reads from a bam file samtools view -b -f 141 ${SAMPLE_ID}.ecoli.bwamem.bam > ${SAMPLE_ID}.unmapped_ecoli_2.bam 1. I …
  • FASTQ exctract ID's
    written by User000 User000
    This is my FASTQ file, @HISEQ1:130:C0G55ACXX:1:2104:6209:41976/2 ATAATATCCAACTTTCACCTATGTTTGAAATGTCTAAAATGTTGTTTGATTAAATTTTGCTCTATGTCATGCTAAGATGATTTAATTCATA + @CCFFFFFHHFHHJJIJJJJIJJJJJJIJIGIHIIIIHIJJHHHIIIJGJGGIJJJJJJIIIJIIIJJJJJJJGGIIJIJIJGEHIGHHHEH @HISEQ1:128:C0HUMACXX:6:1312:1569:61058/1 CATGCATTTAATAACTAATTAACCGTGCATCGGATGTAAATAAATTATATATGAAACTTGCTCAGAATTTTGTGTAGATTAATAATATCCA + CCCFFFFFHHHHHJJJJIJJJJJJJHGIIJJJJJJJHIJIJIJIJJJJJJJIJJJIJIJJJJJIIEHGIJIJHGHEHEHHHHFFFEFFFED I have a list of ID's which where extracted from BAM file …
  • How to break script if Bowtie2 errors?
    written by dfajar2 dfajar2
    Hi, I'll try to explain my problem the best I can. I have a script that runs multiple bowtie2 alignments. The problem is that it …
  • Please help me with samtools
    written by seta seta
    Hi friends, Please help me with the samtools. I used the command of `./samtools view -b -u /home/seta/software/files1_1/8_test.sam | samtools sort -@ 7 -m 10G …
  • Can'T Find Indels With Samtools (Onyly Get Snps)
    written by Max Ivon Max Ivon
    Hello everybody, Could anybody tell me why when I'm using samtools it doesn't find Heterozygous Indels (homozygous are found correctly as SNPs)?? Here is the …
  • Viewing .Bam And .Bai Files In Igv
    written by HNK • HNK
    <p>Hey I have run tophat in galaxy server on sample, and i got deletion, insertion, junction and accepted_hits.bam files. Now i want to view the …