This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Plasmodium falciparum SNPS analysis

I have 29 plasmodium falciparum whole genome sequences that i need to analyse for SNPs. The problem is, each sample contains multiple sequences of upto 768,000 neucleotides....i need to convert this into a single sequence. How do i do this?

genome
• 1,327 views • link
written by kihugaharrison • kihugaharrison

Can you please try to explain better the data that you have? Show examples, if possible.

• 0 views • link
written by Kevin Blighe Kevin Blighe

Dear Kevin,

I have raw whole genome sequences 150 bases long that look like this....

family_nr:-300:family_nt:1639119:genus_nr:-200:genus_nt:5820:species_nr:-100:species_nt:5821:NR::NT:LK023122.1:ST-E00493:300:HFKVJCCXY:6:1217:4584:64632/1
TCATGAAATACAACCATAAAATTGAGTTTTAGGTCCAAAATTCCTTACCTTAACGAAGTCTCTTGATTTCTCTCTTCAGAATCTCCCAAAAAGCTCCAAGGTCGAAGGCAACCATGGTGAAAAAACCCAAAATCGCGAAATGAAATAACA
family_nr:-300:family_nt:1639119:genus_nr:-200:genus_nt:5820:species_nr:-100:species_nt:5821:NR::NT:LK023122.1:ST-E00493:300:HFKVJCCXY:6:1217:4584:64632/2
GATGCGGAAAGGCCTGGGCAGACCATATATGTTATTTCATTTCGCGATTTTGGGTTTTTTCACCATGGTTGCCTTCGACCTTGGAGCTTTTTGGGAGATTCTGAAGAGAGAAATCAAGAGACTTCGTTAAGGTAAGGAATTTTGGACCTA
family_nr:-300:family_nt:1639119:genus_nr:-200:genus_nt:5820:species_nr:-100:species_nt:5821:NR::NT:LK023126.1:ST-E00493:300:HFKVJCCXY:6:2202:3599:38139/1
ATGAGCTAAAAGCAAGGTTATGGGTACGGTAAAGGCTGTTCCAGACCATAAGAAAGAAACAATTGTACACTAAACATACGGTAGAACCACCTTTTCTTACCATATTTGTAATTACTGTATGACATTACTTGAGAAATTGAGGATTTCATT
• 0 views • link
updated by Kevin Blighe Kevin Blighe • written by kihugaharrison • kihugaharrison

That looks like raw illumina data converted to fasta (with a changed header) and interleaved (R1/R2 following each other).

Are these in one file or you have 29 files? It would be useful to have Q-scores for alignments/SNP calling.

If possible you should acquire original fastq format data and start there.

• 0 views • link
written by GenoMax GenoMax

0 answers

No answers yet.

Log in to answer this question.

More posts like this