Biostar Beta. Not for public use.
Plasmodium falciparum SNPS analysis
0
Entering edit mode
14 months ago

I have 29 plasmodium falciparum whole genome sequences that i need to analyse for SNPs. The problem is, each sample contains multiple sequences of upto 768,000 neucleotides....i need to convert this into a single sequence. How do i do this?

genome • 137 views
ADD COMMENTlink
0
Entering edit mode

Can you please try to explain better the data that you have? Show examples, if possible.

ADD REPLYlink
0
Entering edit mode

Dear Kevin,

I have raw whole genome sequences 150 bases long that look like this....

family_nr:-300:family_nt:1639119:genus_nr:-200:genus_nt:5820:species_nr:-100:species_nt:5821:NR::NT:LK023122.1:ST-E00493:300:HFKVJCCXY:6:1217:4584:64632/1
TCATGAAATACAACCATAAAATTGAGTTTTAGGTCCAAAATTCCTTACCTTAACGAAGTCTCTTGATTTCTCTCTTCAGAATCTCCCAAAAAGCTCCAAGGTCGAAGGCAACCATGGTGAAAAAACCCAAAATCGCGAAATGAAATAACA
family_nr:-300:family_nt:1639119:genus_nr:-200:genus_nt:5820:species_nr:-100:species_nt:5821:NR::NT:LK023122.1:ST-E00493:300:HFKVJCCXY:6:1217:4584:64632/2
GATGCGGAAAGGCCTGGGCAGACCATATATGTTATTTCATTTCGCGATTTTGGGTTTTTTCACCATGGTTGCCTTCGACCTTGGAGCTTTTTGGGAGATTCTGAAGAGAGAAATCAAGAGACTTCGTTAAGGTAAGGAATTTTGGACCTA
family_nr:-300:family_nt:1639119:genus_nr:-200:genus_nt:5820:species_nr:-100:species_nt:5821:NR::NT:LK023126.1:ST-E00493:300:HFKVJCCXY:6:2202:3599:38139/1
ATGAGCTAAAAGCAAGGTTATGGGTACGGTAAAGGCTGTTCCAGACCATAAGAAAGAAACAATTGTACACTAAACATACGGTAGAACCACCTTTTCTTACCATATTTGTAATTACTGTATGACATTACTTGAGAAATTGAGGATTTCATT
ADD REPLYlink
1
Entering edit mode

That looks like raw illumina data converted to fasta (with a changed header) and interleaved (R1/R2 following each other).

Are these in one file or you have 29 files? It would be useful to have Q-scores for alignments/SNP calling.

If possible you should acquire original fastq format data and start there.

ADD REPLYlink

Login before adding your answer.

Similar Posts
Loading Similar Posts
Powered by the version 2.3