Anyone could help me to find an online software (or for free use in Windows OS) to produce a plot based on a sliding window analysis of DNA or Protein sequence identities?
Dear all, I have fasta seguence like this: CCCCAAAGACACCCCCCACAGTTTATGTAGCTTACCCCTTTT I would like to calculate the complexity of this sequence based on sliding window of 3-4 …
I want to implement software(python script) to identify genic regions based on codon usage analysis, specifically codon usage log-likelihood. I have 2 files one is …
Is there an already existing tool to generate a matrix of pairwise protein identities/similarities for an input which consists of multiple protein sequences? I did …
Hi; I am looking for a tool which does Protein **Sequence alignment** based on their **3D structure alignment**. I have found **STACCATO**(http://www.doe-mbi.ucla.edu/Software/STACCATO.html) which is nice …
<p>I am looking for a sliding window program or server like <a href="http://www.ncbi.nlm.nih.gov/pubmed/9682061">"SWAN: sliding window analysis of nucleotide sequence variability"</a> or <a href="http://www.ncbi.nlm.nih.gov/pubmed/15130925">"SWAPSC: sliding window …
<p>Hi, dear members, I want to use DFR sliding window analysis to compute total T scores and differential scores per million base pairs from neighboring …
Just so we're clear, the first "window" in your statement refers to the Windows OS, correct?
You are right. Now it is better explained.
Question is unclear, it is unclear which data you have and what you aim to achieve.
Thank friend. It is better now.