This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Looking for a DNA -> Protein Sample/Example.

Hello everyone!

I am looking for a real example of a DNA sequence that codes for a real (any) protein. the shorter, the better.

I have the following Fake/Randomly Generated sequence:

"AAAGAACATGACTCCAATTTCGGAACCAAGTAGTTAAATCCTGTGA"

And it has the following Fake/Not Real/Test protein sequence:

'M', 'T', 'P', 'I', 'S', 'E', 'P', 'S', 'S', '_'

'MTPISEPSS'

I need this to test some of my code, but I can't seem to find any DNA Example sequences online that code for a real protein. If anyone has an example or a way to get that from any Gene Banks, please let me know.

Regards, Juris.

dna protein sequence
• 1,485 views • link
written by rebelCoder • rebelCoder

1 answer

I got some help from IRC, so this is no longer a problem:

Insulin DNA Sequence:

enter image description here

Protein Sequence: enter image description here

• 0 views • link
written by rebelCoder • rebelCoder

Log in to answer this question.

More posts like this