This is a test version of Biostars. For the public version, visit https://www.biostars.org.
primer trim software

how to extract primer sequences from raw data (fastq) with two-way reading (R1 and R2 (pair-end)). I've tried a lot of programs for this (cutPrimer, fastqc, cutadapt, some of them)

ngs primer trimming pair-end read

1 answer

Are you sure you have primers in your reads?

You can use reformat.sh from BBMap suite as follows:

$ reformat.sh in=reads.fq out=trimmed.fq ftr=19

This will trim all but the first 20 bases (all bases after position 19, zero-based). Adjust this number as needed.

$ kmercountexact.sh in=trimmed.fq out=counts.txt fastadump=f mincount=10 k=20 rcomp=f

This will generate a file containing the counts of all 20-mers that occurred at least 10 times, in a 2-column format that is easy to sort in Excel.

ACCGTTACCGTTACCGTTAC    100
AAATTTTTTTCCCCCCCCCC    85

...etc. If the primers are 20bp long, they should be pretty obvious.

Yes, I have primer sequences in my readings and I have to get rid of them, but all the programs I use are interestingly erasing all readings. Can you share a sample command in my BBmap program, how do I extract primer arrays? my primer sequences are 19-24 nucleotides in length

Log in to answer this question.