About a script which doesn't execute
I have a query about a genome assembly What could have gone wrong in case a script does not execute?
I hope you to be able to answer my question, I'll be really glad.
assembly
genome
• 870 views
•
link
written
by
stephanycollinsdelgado
0
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Using other individuals and related species to improve a de novo genome assembly
written by Ed 991 1Hi all - I have a question regarding how to generate a "good enough" genome assembly for comparative genomics purposes (across species). For some species, …
-
Assembly size is double the genome size despite specifying --genome-size in flye
written by gilmahu 0Dear All, I have used flye to assemble two nanopore reads. One looks fine but one assembly even after the polishing step is twice the …
-
BWA MEM/Can BWA use bam file to re-align it to the new ref.fa?
written by Qboy 1Hey, community! I have a question. Can BWA-MEM use BAM/CRAM file and re-align to the new reference genome? I would be glad if you could …
-
Read quality only 14
written by ericjanhoekstra 0I just did an FASTQC on a very low quality fastq file. This is a part of the fastq file: -- GGGATACCAAGAGGTCTTTATTGCCCACCACTCTGCAC +SRR1106118.1 VHE-8221810561012-4-6-0-0 length=38 …
-
databases in ncbi
written by guardsquirrel 0Hi, I was wondering what the difference was between the ncbi nucleotide nt/nr database was to the refseq genome database and the refseq representative genome …
-
Blast an organism against a downloaded database
written by caro-ca 2Hi, Biostar community! I am trying to do a blastn with my genome assembled on Linux against an organism that only has one public assembled …
-
perl script 'blast_rod_finder.pl' not giving output but no errors either
written by Lau 0Hi, I apologize about this question in case its easy answer, I have been trying to run this script written in perl blast_rod_finder.pl (*https://github.com/aleimba/bac-genomics-scripts/tree/master/rod_finder*), which …
-
Transcriptome Assembly Quastions
written by tawares07 0Hi guys! I have been using transcriptome assembly (genome-guided) to identify novel alternative splicing transcripts in human transcriptome. After the execution of mapping and assembly, …
-
BAM file statics and heterozygoty rate
written by kk.mahsa 15i have two question and hope to help me 1- what program or script can calculated assembly coverage (as the proportion of bases in the …
-
Genome annotation tools - current status. Machine learning?
written by liorglic 150Hi there, I am getting started with learning genome annotation. After reading a few (somewhat theoretical) review papers, I thought it'd be nice to hear …
please read How To Ask Good Questions On Technical And Scientific Forums and edit your question. Thank you.