This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Sequence identity between sequences with different lengths

Hello,

A simple question. What is the sequence identity between 2 sequences when one is much larger than the other?

Example:

seq1:  -------------------AGTGTGAAAAAGGT----------------
seq2:  ATATATGCGCATGGTAATAAGTGTGAAAAAGGTTATATGCGCATAAGGT

The smaller sequence corresponds 100% to a subset of the bigger one. Do they have 100% identity? Or rather something like 30%, as seq1 corresponds to 30% of seq2?

The reason why I ask this is that I am filtering an alignment of two assemblies of the same genome (with nucmer/mumer) and I can filter out aligned contigs based on identity.

Thank you,
Ricardo

sequence identity alignment filter mummer
• 2,781 views • link
updated by Bastien Hervé Bastien Hervé • written by ricardoguerreiro2121 ricardoguerreiro2121

Would have say that, if you look at seq1 it has 100% identity on 100% of its length, if you look at seq2 it has 100% identity on 30% of its length, it's a point a view

• 1 views • link
written by Bastien Hervé Bastien Hervé

I would say seq1 is 100% identical to seq2, while seq2 is only 30% identical to seq1 .

unfortunately heavily depending on how you look at this

• 1 views • link
written by lieven.sterck lieven.sterck

Great, that's it, thanks! It depends on what is the query and what is the reference. Thanks! (If you write it as an answer instead of a comment I'll accept it)

• 1 views • link
written by ricardoguerreiro2121 ricardoguerreiro2121

It also depends on whether you use global or local alignment.

• 1 views • link
written by Benn Benn

0 answers

No answers yet.

Log in to answer this question.

More posts like this