This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Include STOP codon in getorf output

I am using getorf from EMBOSS. I want to include the STOP codon in my output file in the nucleotide format. But no matter what I try, the output is without STOP codon. Any suggestions? Example: My input file (named as input.fa) is:

>a
TAGATCCTTTCTTTCTTGTCTCTATATTACAAGGGAGTACAAAAAAGGATTATGAATATATGAAAAGAAAATTTTGAAGATAAATAAAACGGCAATTTACGTACCTAGAACAATGGCAGGACGTACTCAGGCCCTGTCCCAATCAAACATGCCATGCACATACATCTATTCTTGAAATCTCAAGGGAGACTATTTTCTAAAAAGCACCAGATTTTTTCAATTGAACATAACAGGCAACAAATGGAATAGCAAATCCAACAGCGAAGAACCCAAAATGAGAAAGAGCATAGGGCGTCTTTCTACCTTTGACTTTGAATGGAATATTCTCATACACACCATCTTTGAAATGGACTGATCTCTTCATGATAATTGGTCTAGCCATAATATTGCTACTTCTCTTTGCTGCGGTTCTAATCATTTGTTGGCACAACATTGTGTATTGAGTATGACTTCTTCTCTATTTAATTGATATGTTGTATGCTTTCTTGAAATCAGTAGACTATAAGATCGTTCTTGTAAATCATTAATCTAACCTTATGAGTTATGCTGTGGTCAATCTTTATTTTCTGTTTTTCTTGATCCCCTAGCTCTTCCGTAAACACCGAACACTTTCTCTCACATGATTGGTGCAAA

output file looks like (named as longest.fa) :

>a_3 [433 - 200] (REVERSE SENSE) 
ATGTTGTGCCAACAAATGATTAGAACCGCAGCAAAGAGAAGTAGCAATATTATGGCTAGA
CCAATTATCATGAAGAGATCAGTCCATTTCAAAGATGGTGTGTATGAGAATATTCCATTC
AAAGTCAAAGGTAGAAAGACGCCCTATGCTCTTTCTCATTTTGGGTTCTTCGCTGTTGGA
TTTGCTATTCCATTTGTTGCCTGTTATGTTCAATTGAAAAAATCTGGTGCTTTT

as you can see, this does not have a stop codon in the end. the command that I used is: hmmer2go getorf -i input.fa -o longest.fa -t3 I want stop codon to be included.

emboss getorf orf stop
• 4,131 views • link
updated by pmcarlton • pmcarlton • written by lokdeep17 • lokdeep17 
hmmer2go getorf --man

Does it have such option?

• 1 views • link
written by 5heikki 5heikki

I couldn't either. Weird they didn't give the option

• 1 views • link
written by Asaf Asaf

I doubt many people use it for protein prediction these days..

• 1 views • link
written by 5heikki 5heikki

If there's some other ORF finder to do this job, please suggest it to me.

• 1 views • link
written by lokdeep17 • lokdeep17

are you looking for true ORFs as in genes or simply ORFs between two stopcodons?

Perhaps get_longest_orf, TransDecoder, FrameD, ... can be of use (most will look for true genes though)

• 1 views • link
written by lieven.sterck lieven.sterck

I tried get_longest_orf.pl, it also does not include STOP codon in the output.

• 1 views • link
written by lokdeep17 • lokdeep17

you are correct. and as it turns out it itself is based on EMBOSS so to be expected behavior (and thus my bad to list that one)

• 1 views • link
written by lieven.sterck lieven.sterck

Prodigal is a great tool but for microbes.

• 1 views • link
written by Asaf Asaf

Why do you think it's just for microbes?

-g:  Specify a translation table to use (default 11).
• 0 views • link
written by 5heikki 5heikki

It's not just the translation table, it's identifying TSS and other stuff. Take a look at the paper

• 0 views • link
written by Asaf Asaf

1 answer

I was just searching for the same question, and I'll post my solution here in case it helps anyone. It uses extractseq from EMBOSS and perl.

The output of getorf gives each sequence a name that includes the start and stop locations within the original file.

So, if you add 3 to the stop location, and send those coordinates to extractseq you should get the sequence plus the stop codon.

My code is here, assuming "ORFs.fa" is the fasta file generated by getorf and dna.fa is the file you originally passed to getorf:

grep '>' ORFs.fa | tr -d '>[]' | perl -ane '$n=$F[0];$n =~ s/_\d+$//; $s=$F[1];$e=$F[3]+3;print "extractseq -seq dna.fa:$n -reg $s,$e -out stdout\n"' > orfplusstop-get.sh```

then executing "sh orfplusstop-get.sh > orfsplusstop.fa" should get what you want.

• 0 views • link
written by pmcarlton • pmcarlton

Log in to answer this question.

More posts like this