Biostar Beta. Not for public use.
Include STOP codon in getorf output
0
Entering edit mode
11 months ago
lokdeep17 • 0

I am using getorf from EMBOSS. I want to include the STOP codon in my output file in the nucleotide format. But no matter what I try, the output is without STOP codon. Any suggestions? Example: My input file (named as input.fa) is:

>a
TAGATCCTTTCTTTCTTGTCTCTATATTACAAGGGAGTACAAAAAAGGATTATGAATATATGAAAAGAAAATTTTGAAGATAAATAAAACGGCAATTTACGTACCTAGAACAATGGCAGGACGTACTCAGGCCCTGTCCCAATCAAACATGCCATGCACATACATCTATTCTTGAAATCTCAAGGGAGACTATTTTCTAAAAAGCACCAGATTTTTTCAATTGAACATAACAGGCAACAAATGGAATAGCAAATCCAACAGCGAAGAACCCAAAATGAGAAAGAGCATAGGGCGTCTTTCTACCTTTGACTTTGAATGGAATATTCTCATACACACCATCTTTGAAATGGACTGATCTCTTCATGATAATTGGTCTAGCCATAATATTGCTACTTCTCTTTGCTGCGGTTCTAATCATTTGTTGGCACAACATTGTGTATTGAGTATGACTTCTTCTCTATTTAATTGATATGTTGTATGCTTTCTTGAAATCAGTAGACTATAAGATCGTTCTTGTAAATCATTAATCTAACCTTATGAGTTATGCTGTGGTCAATCTTTATTTTCTGTTTTTCTTGATCCCCTAGCTCTTCCGTAAACACCGAACACTTTCTCTCACATGATTGGTGCAAA

output file looks like (named as longest.fa) :

>a_3 [433 - 200] (REVERSE SENSE) 
ATGTTGTGCCAACAAATGATTAGAACCGCAGCAAAGAGAAGTAGCAATATTATGGCTAGA
CCAATTATCATGAAGAGATCAGTCCATTTCAAAGATGGTGTGTATGAGAATATTCCATTC
AAAGTCAAAGGTAGAAAGACGCCCTATGCTCTTTCTCATTTTGGGTTCTTCGCTGTTGGA
TTTGCTATTCCATTTGTTGCCTGTTATGTTCAATTGAAAAAATCTGGTGCTTTT

as you can see, this does not have a stop codon in the end. the command that I used is: hmmer2go getorf -i input.fa -o longest.fa -t3 I want stop codon to be included.

ADD COMMENTlink
0
Entering edit mode
hmmer2go getorf --man

Does it have such option?

ADD REPLYlink
0
Entering edit mode

I couldn't either. Weird they didn't give the option

ADD REPLYlink
0
Entering edit mode

I doubt many people use it for protein prediction these days..

ADD REPLYlink
0
Entering edit mode

If there's some other ORF finder to do this job, please suggest it to me.

ADD REPLYlink
0
Entering edit mode

I haven't done this for quite a few years, but back then I swore by https://github.com/hyattpd/Prodigal

ADD REPLYlink
0
Entering edit mode

are you looking for true ORFs as in genes or simply ORFs between two stopcodons?

Perhaps get_longest_orf, TransDecoder, FrameD, ... can be of use (most will look for true genes though)

ADD REPLYlink
0
Entering edit mode

I tried get_longest_orf.pl, it also does not include STOP codon in the output.

ADD REPLYlink
1
Entering edit mode

you are correct. and as it turns out it itself is based on EMBOSS so to be expected behavior (and thus my bad to list that one)

ADD REPLYlink
0
Entering edit mode

Prodigal is a great tool but for microbes.

ADD REPLYlink
0
Entering edit mode

Why do you think it's just for microbes?

-g:  Specify a translation table to use (default 11).
ADD REPLYlink
0
Entering edit mode

It's not just the translation table, it's identifying TSS and other stuff. Take a look at the paper

ADD REPLYlink

Login before adding your answer.

Similar Posts
Loading Similar Posts
Powered by the version 2.1