read.fasta() function couldn't found · Biostar

This is a test version of Biostars. For the public version, visit https://www.biostars.org.

read.fasta() function couldn't found

Hi I'm new to R and today I'm trying to import a fasta file using read.fasta() function from the seqinr library, however, it threw a error message said that "could not find function "read.fasta", I installed seqinr, import the library at the beginning and couldn't see any typo in my code, any help? I'm using R studio.

library(seqinr)

cox1 <-read.fasta(file = "cox1.fasta",  seqtype="AA")

r fasta

• 5,445 views • link

updated 7.6 years ago by GenoMax

• written 7.6 years ago by sherlockyz •

Please show the output of sessionInfo()

• 0 views • link

written 7.6 years ago by WouterDeCoster

Can you try seqinr::read.fasta()?

• 0 views • link

written 7.6 years ago by Ram

0 answers

No answers yet.

Log in to answer this question.

More posts like this

How to use a protein alignment fasta file when using the function cluster of Kmer package
written 4.9 years ago by pamela.obando •

Hello everyone, I'm trying to use the function **cluster** of the **kmer** package in order to obtein a dendogram of a large set of protein …
errors in multiple sequencing alignment in r by use msa package!!
written 5.5 years ago by kasemmohmmed287 •

hi i am try to do multiple sequencing alignment in r by use msa package, so i download fasta file form NCBI and read it …
Fasta Files - How to search for peptide sequences?
written 6.1 years ago by janainamace •

Hello, I have a large file with 105 protein sequences. To obtain this file I used the 'seqinr' function: library (seqinr) myfasta <- read.fasta (file …
Problem with seqinr::load.fasta "The specified file does not exist."
written 6.2 years ago by carroll •

Hi everyone, I'm having troubles importing a FASTA file using load.fasta() from the kodonz package. I installed and loaded the package, then: library("kodonz") library("seqinr") # …
how to create a fasta file with subset of sequences using seqinr
written 7.6 years ago by Camilla •

Hi everyone, I am very new in environment R. I am trying to obtain a final fasta file selecting a subset of sequences from a …
Multi Pairwise Sequence Alignment in R
written 11.0 years ago by mastercod3r •

Hello guys, I am final year bioinformatics student, doing internship at the moment. So I am sorry for my noobiness in advance. Here is what …
fasta file loading error
written 11.1 years ago by tcf.hcdg

Hello I hava a sequence file containing 10,22,058 entries in fasta format. I wanted to load this file in the R using "seqinr" package. I …
Subsetting a fasta file using seqinr in R
written 11.6 years ago by henrikkjeldal •

I am trying to subset a fasta file like described in another post (https://www.biostars.org/p/93056/). I simply want to be able to extract a subset of …
How To Extract Multiple Fasta Sequences At A Time From A File Containing Sequences Ids Using R
written 12.5 years ago by catagui •

<p>Hello I will like to know how can I extract multiple fasta sequences from a file that have a list of the IDs (133 in …
Seqinr Cannot Recognize ">" Character In File
written 14.3 years ago by Partha •

<p>i have a fasta file of nucleic acid sequences with sequences beginning like </p> <pre><code>>YHR055C cdna:known chromosome:EF4:VIII:214533:214718:-1 gene:YHR055C gene_biotype:protein_coding transcript_biotype:protein_coding ATGTTCAGCGAATTAATTAACTTCCAAAATGAAGGTCATGAGTGCCAATGCCAATGTGGT AGCTGCAAAAATAATGAACAATGCCAAAAATCATGTAGCTGCCCAACGGGGTGTAACAGC GACGACAAATGCCCCTGCGGTAACAAGTCTGAAGAAACCAAGAAGTCATGCTGCTCTGGG AAATGA </code></pre> …