This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to Separate a SAM File Containing Forward and Reverse Reads

I got 0 plus and minus reads by aligning single reads against a gene in the following way:

> bwa index ref.fasta
> bwa mem ref.fasta sample5-21.fq | gzip -3 > sample5-21.sam.gz
> splitsam.sh sample5-21.sam.gz forward.sam.gz reverse.sam.gz
Total reads:    1792444
Plus reads:     0
Minus reads:    0
Unmapped reads: 1792444
Time:           1.166 seconds.

What did I miss?

gene alignment rna-seq
• 2,152 views • link
written by Ric Ric

Hello Ric ,

it is unusual to gzip sam files. Instead you should convert it to sorted bam files using samtools sort -o output.bam input.sam.

But as splitsam.sh doesn't complain about the format, this is not your problem here.

Please convert to sorted bam and post the output of:

$ samtools flagstat output.bam

fin swimmer

• 0 views • link
written by finswimmer finswimmer

Did you check the results of bwa mem? According to splitsam.sh, there aren't maped reads in your sam file. Try:

zcat sample5-21.sam.gz | samtools view | head

and:

zcat sample5-21.sam.gz | samtools view | tail

Indeed it is really strange to use gzipped sam files, but this is allowed by splitsam.sh (part of BBTools) - and apparently, splitsam.sh doesn't take bam as input. But I wouldn't gzip sam files, as very few tools will accept gzipped sam.

edit: take note you are also using splitsam.sh incorrectly, as it expects at least four arguments:

Usage:        splitsam <input> <plus output> <minus output> <unmapped output>

Input may be stdin or a sam file, raw or gzipped.
Outputs must be sam files, and may be gzipped.
• 0 views • link
written by h.mon h.mon 
samtools flagstat sample5-21.sorted.bam
1792444 + 0 in total (QC-passed reads + QC-failed reads)
0 + 0 secondary
0 + 0 supplementary
0 + 0 duplicates
0 + 0 mapped (0.00% : N/A)
0 + 0 paired in sequencing
0 + 0 read1
0 + 0 read2
0 + 0 properly paired (N/A : N/A)
0 + 0 with itself and mate mapped
0 + 0 singletons (N/A : N/A)
0 + 0 with mate mapped to a different chr
0 + 0 with mate mapped to a different chr (mapQ>=5)
• 0 views • link
written by Ric Ric 
> samtools view sample5-21.sorted.bam | head
NS500334:143:H3GTHBGX9:4:11401:23521:1002   4   *   0   0   *   *   0   0   NCGGACCAGGCTTCATTCCCC   *   AS:i:0  XS:i:0
NS500334:143:H3GTHBGX9:4:11401:16217:1008   4   *   0   0   *   *   0   0   NCGGACCAGGCTTCATTCCCC   *   AS:i:0  XS:i:0
NS500334:143:H3GTHBGX9:4:11401:9757:1012    4   *   0   0   *   *   0   0   NCGGACCAGGCTTCATTCCCC   *   AS:i:0  XS:i:0
NS500334:143:H3GTHBGX9:4:11401:16357:1016   4   *   0   0   *   *   0   0   TATATGTTCTCAGGTCGCCCC   *   AS:i:0  XS:i:0
NS500334:143:H3GTHBGX9:4:11401:15714:1027   4   *   0   0   *   *   0   0   TTCGGACCAGGCTTCATTCCC   *   AS:i:0  XS:i:0
NS500334:143:H3GTHBGX9:4:11401:2589:1037    4   *   0   0   *   *   0   0   TCGGACCAGGCTTCATTCCCC   *   AS:i:0  XS:i:0
NS500334:143:H3GTHBGX9:4:11401:8137:1041    4   *   0   0   *   *   0   0   TCGGACCAGGCTTCATTCCCC   *   AS:i:0  XS:i:0
NS500334:143:H3GTHBGX9:4:11401:21304:1044   4   *   0   0   *   *   0   0   TCGGACCAGGCTTCATTCCCC   *   AS:i:0  XS:i:0
NS500334:143:H3GTHBGX9:4:11401:17205:1078   4   *   0   0   *   *   0   0   GTGTACGCGTCAGCTGCTGCT   *   AS:i:0  XS:i:0
NS500334:143:H3GTHBGX9:4:11401:19354:1079   4   *   0   0   *   *   0   0   AACAGACCGGTAGACTTGAAC   *   AS:i:0  XS:i:0


> samtools view sample5-21.sorted.bam | tail
NS500334:143:H3GTHBGX9:1:23312:10665:20320  4   *   0   0   *   *   0   0   TCGGACCAGGCTTCATTCCCC   *   AS:i:0  XS:i:0
NS500334:143:H3GTHBGX9:1:23312:7465:20341   4   *   0   0   *   *   0   0   TCGGACCAGGCTTCATTCCCC   *   AS:i:0  XS:i:0
NS500334:143:H3GTHBGX9:1:23312:2947:20342   4   *   0   0   *   *   0   0   TCCGGGCTTTACTTGTACAGC   *   AS:i:0  XS:i:0
NS500334:143:H3GTHBGX9:1:23312:22490:20344  4   *   0   0   *   *   0   0   ACCGCATCGAGCTGAAGGGCA   *   AS:i:0  XS:i:0
NS500334:143:H3GTHBGX9:1:23312:24199:20360  4   *   0   0   *   *   0   0   TCGGACCAGGCTTCATTCCCC   *   AS:i:0  XS:i:0
NS500334:143:H3GTHBGX9:1:23312:22936:20364  4   *   0   0   *   *   0   0   TCGGACCAGGCTTCATTCCCC   *   AS:i:0  XS:i:0
NS500334:143:H3GTHBGX9:1:23312:13141:20379  4   *   0   0   *   *   0   0   GGAGACTCGAACTCACAACCT   *   AS:i:0  XS:i:0
NS500334:143:H3GTHBGX9:1:23312:2345:20381   4   *   0   0   *   *   0   0   CACCTACGGCAAGCTGACCCT   *   AS:i:0  XS:i:0
NS500334:143:H3GTHBGX9:1:23312:17238:20382  4   *   0   0   *   *   0   0   CCCAAAGGAGAAGCTCAACTC   *   AS:i:0  XS:i:0
NS500334:143:H3GTHBGX9:1:23312:15492:20404  4   *   0   0   *   *   0   0   CGGAGATTACAATGGACGATT   *   AS:i:0  XS:i:0
• 0 views • link
written by Ric Ric

The reference is 5044 bp long and the reads are 21 bp long. Should I use a different aliger and if yes then which one?

• 0 views • link
written by Ric Ric

Yes, bwa mem is intended to reads 70 base pairs or longer, you should use another aligner. I would recommend Bowtie (preferred) or Bowtie2 (you may have to tweak the settings).

Could you please report back if this improves alignment? Thanks.

• 0 views • link
written by h.mon h.mon

0 answers

No answers yet.

Log in to answer this question.

More posts like this