This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Mapping To Genome With Ambiguous Reference Characters (R,Y,K,M,S,W Etc.)

I am mapping illumina reads using bowtie/bwa to a reference genome with ambiguous reference characters (N, -, R, Y,K,M,S,W etc.).

For example: At a particular location where ambiguous reference character exists (R), I want read with either A or G to be matched as perfect match.

In the below case using bowtie, read is not able to match to the reference.

Reference: ATTCAAGCCCMGAGCGTMTATAAKGGAAGCTKCGCGTGTGTATGCATCAATTGGCAAGATGTTGTG Read:
ATTCAAGCCCAGAGCGTCTATAATGGAAGCTTCGCGTGTGTATGCATCAATTGGCAAGATGTTGTG

Can you suggest options to set within bowtie/bwa or suggest other alignment tool where I can acheive this.

I learnt that "Alignments involving one or more ambiguous reference characters (N, -, R, Y, etc.) are considered invalid by Bowtie."

mapping bowtie bwa reference
• 11,526 views • link
updated by Andreas Andreas • written by Rm Rm

Strictly speaking, bowtie, as well as bwa, takes an ambiguous base as a random A/C/G/T. They regard a match to an ambiguous base as a mismatch after mapping.

• 0 views • link
written by lh3 lh3

2 answers

GSNAP, Mosaik and novoalign.

• 1 views • link
written by lh3 lh3

Thanks @lh3, I accept your answer; but I am trying SOAPaligner/soap2

• 0 views • link
written by Rm Rm

I do not know if soap2 accepts ambiguous bases. In general, soap2 is great, but it does not natively support SAM output, which might cause problems for downstream analyses. If you have to use one, I would recommend novoalign.

• 0 views • link
written by lh3 lh3

By design, it is hard for a BWT based aligner to work with ambiguous bases in the expected way.

• 0 views • link
written by lh3 lh3

I am not happy with SOAPaliner...currently trying GSNAP....

• 0 views • link
written by Rm Rm

@Lh3; finally after looking to all three you suggested, going ahead with Mosaik. Thanks!

• 0 views • link
written by Rm Rm

If your intention is to reduce the reference bias, I am sure novoalign and gsnap implement that correctly. As mosaik is not published (novoalign is not published but I have discussed this with its developer), I do not know if it does that correctly. Note that claiming a feature does not necessarily mean the feature is implemented correctly.

• 266 views • link
written by lh3 lh3

RazerS accepts ambiguity characters as well: http://www.seqan.de/projects/razers.html

Andreas

Edit: Does not seem to be fully correct. See comments. Only N is supported.

• 1 views • link
written by Andreas Andreas

thanks @Andreas, BTW do you know which options to use in razer to make use of ambiguous bases in reference sequence

• 0 views • link
written by Rm Rm

In RazerS, I did not see any parameter to support ambiguous bases except "-mN" which only allows "N" to match to any base (ATGC).

• 0 views • link
written by Rm Rm

I enquired with the Razers authors they say it doesnot support the Ambiguous bases except "N"

• 0 views • link
written by Rm Rm

Ok. Thanks for your investigation and clarification. Edited my answer.

• 0 views • link
written by Andreas Andreas

Log in to answer this question.

More posts like this