How to uninstall mirdeep2 tool?
Hi all,
I wanted to uninstall mirdeep2-master thats been installed in my ubuntu platform. Could someone help me with it?
Thanking You in advance
mirdeep2
• 2,747 views
•
link
written
by
nivya.james2016
0
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Biobakery virtual machine installation
written by anjalivasudevan98 4Hii Can anyone please help with the installation of bio bakery on a virtual machine? I'm installing this on a Linux platform (installed through virtual …
-
Running mirdeep2 mapper.pl problems
written by lachlan.gray95 0Hi all! After locally installing mirdeep2 and its dependencies with the suggested command: perl install.pl When I attempted to run the mapper.pl script I was …
-
mirdeep2 installation error
written by szabo.marton 1Hi! I've tried to use mirdeep2 package to miRseq analysis on Ubuntu. However I have no previous experience with seq analysis nor using Ubuntu surface. …
-
How to rectify mirdeep.pl error?
written by nivya.james2016 0Hi all, Could you help me rectify this error? mkdir mirdeep_runs/run_13_12_2018_t_16_20_32 #testing input files #testing input files started: 16:20:33 sanity_check_mature_ref.pl /home/shanthi/Desktop/Nivya/miRBase/mature_human_miRNA1.fa Error: problem with /home/shanthi/Desktop/Nivya/miRBase/mature_human_miRNA1.fa …
-
How to remove special characters from text files?
written by nivya.james2016 0Hi all I have an miRNA text file (having ~2000 miRNA information) like the following >hsa-miR-576-3p MIMAT0004796 AAGAUGUGGAAAAAUUGGAAUC >hsa-miR-140-5p MIMAT0000431 CAGUGGUUUUACCCUAUGGUAG i want it to …
-
miRdeep2 mapper error
written by nivya.james2016 0Hi all, I am trying to map my miRNA reads to the genome using the miRDeep2 mapper but is facing an error. Kindly help me. …
-
Is it important to take the same replicates for control and treated samples?
written by nivya.james2016 0Hi all, I am new to NGS analysis. I have this doubt; is it a must to take the same replicates for all the reads …
-
What is the purpose of having reference genome of other species during miRDeep2?
written by nivya.james2016 0Hi all, I am doing miRNA Seq analysis and I am new to it. I have indexed my genome using bowtie and mapped it. Inorder …
-
Gotoh Implementation of Smithwaterman in Perl or Bioperl
written by swttalyan 1Hi, I am looking for the Gotoh Implementationm of Smithwaterman(optimized) in perl or Bioperl which is has computational complexity O ( mn ) .It will …
-
miRDeep2 generated EMPTY signature.arf
written by Pei 26Hi All: I am running miRDeep2.pl but found the resulting signature.arf is empty. (my miRDeep2 fails to generate any useful results and I think this …
It depends on how you've installed it. Via package manager? compiled on your own (how?)? Just extracted an archiv?
fin swimmer
I downloaded it from git-hub and extracted it. Then i installed it using
sudo perl install.pl.Hello nivya.james2016 ,
it is obviously to late, but: Never ever use
sudoto install a program in linux, except for the package manager of your distribution. The package manager is the only one who know which files belong to which program and is able to remove all these files without violate any dependencies. Furthermore of you bypass the package manager for a system wide installation, you may get problems when installing a package via package manager later. Because than it will find files that do not belong to any package and will not know how to handle it.In summary: Unfortunately A cannot help you on how you can uninstall mirdeep2 in your case.
For the future I recommend having a look at bioconda for easily installing and removing of bioinformatic tools. As an introduction on how to use it, you can have a look at the first part of a tutorial I've written some time ago.
fin swimmer
thank you so much for your help. I shall do this in future.
I know next to nothing about Perl, and what little I do is based around using
perlbrewandcpanm(absolutely the best way to install perl stuff if you have the option), however a few seconds on google threw this up:https://www.perl.com/article/3/2013/3/27/How-to-cleanly-uninstall-a-Perl-module/
Thank you so much jrj.healey for your help. I am trying the methods. Kindly help me again if i am not able to execute.
Hi jrj.healey,
I checked the link and was trying to do as per the instructions but came up with an error
Could you tell me whats wrong? Thank you in advance
Are you sure the module is called exactly
mirdeep2-masterand not something else? How would you normally import it in Perl?At a guess, it sounds like it hasn’t found a matching model for that particular syntax of the module name (or it isn’t actually installed after all)