Thanks for your answer. So just to be clear, should I just have
>adaptor1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
and omit NNNNNNATCTCGTATGCCGTCTTCTGCTTG?
I have a few samples of RNA-seq data. I have this adaptor sequience (AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG (NNNNNN= 6 nt index)). Can someone please tell me what NNNNNNN =6 index indicates here? I was using BBMap tools to do the trimming and created the adaptor file like below, but I do not see any change in my new trimmed file (in terms of file size).
>adaptor1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
I would not worry about what NNNNN is, if the core sequence you are trying to remove is common. Use literal=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ktrim=r to get all variations of NNNNN.
Thanks for your answer. So just to be clear, should I just have
>adaptor1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
and omit NNNNNNATCTCGTATGCCGTCTTCTGCTTG?
Log in to answer this question.
firstly, file size is not always the best indicator of success or failure ;-) .
where did you get that adaptor sequence from? Did the seq facility provide that to you? I think they simply want to indicate there is a 6nt index present at the location of the Ns
Yes, it was provided by the sequencing facility.
and they did not provide any additional information, eg. what the index might be then?
long shot, but might they be present in the read headers in the fastq file?
No, they did not provide anymore information, except for that adaptor sequence. The fastq header only has this info:
What does the summary stats say about the trimming? Perhaps there are no adapters (always theoretically possible) or you were given an incorrect adapter sequence (also possible).