This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Trimmomatic not trimming the adapter

Hello,

I am using Trimmomatic to trim the adapter sequence from the raw small RNA data. For some reason after trimming I still find the adapter in the trimmed sequence. Does anyone have any suggestion?

This is the command I am using:

java -jar trimmomatic SE -phred33 -threads 10 file_in file_out ILLUMINACLIP:adapter.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 CROP:34 MINLEN:18

This is the raw sequence data (as an example) - the adapter sequence is in bold:

@SN741:1069:CCAUHACXX:2:2201:1721:2117 1:N:0:ATCACG
NAGCGTTGGATTGTTCACCC**TGGAATTCTCGGGTG**CCAAGGAACTCCAGTC
+

Here is the trimmed sequence after running Trimmomatic:

@SN741:1069:CCAUHACXX:2:2201:1721:2117 1:N:0:ATCACG
AGCGTTGGATTGTTCACCC**TGGAATTCTCGGGTG**
+

Any help is appreciated.

trimmomatic small rna
• 3,889 views • link
updated by Biostar Biostar • written by S S

Please use the formatting bar to indicate code. I did it for you this time.

bar

• 1 views • link
written by ATpoint ATpoint

Sorry, I will do next time, I overlook it. Thanks!

• 1 views • link
written by S S

Hi Alex,

I actually did try a different tool in the meantime. I tried cutadapt and it worked perfectly. However, I am still wondering whether Trimmomatic will still work for this or not.

Thanks!

• 1 views • link
written by S S

Could you please show the content of adapter.fa and also a complete fastq entry including the quality values for the read bases?

fin swimmer

• 1 views • link
written by finswimmer finswimmer

Hi finswimmer,

The contents of the adapter.fa is indicated in my question under the double asterisk. I meant for it to be displayed in bold but not sure why it isn't. I think it is because it is under the code block? Below is the raw sequence with the quality values.

@SN741:1069:CCAUHACXX:2:2201:1721:2117 1:N:0:ATCACG
NAGCGTTGGATTGTTCACCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTC
+
#0<FFFFFBBFFFFIFFFFFIIIIFFFIIIFBF0BBFIFF0000BFFFIFB

Thanks!

• 1 views • link
written by S S

are you sure it's using the sequence from your own adapter.fa file (and not the 'build-in' one)? Perhaps try running it with ILLUMINACLIP:./adapter.fa:2:30:10 (specifically point to the 'local' file)

• 1 views • link
written by lieven.sterck lieven.sterck

Yup. That is the first thing I checked. Thanks for the suggestion though.

• 0 views • link
written by S S

can you post a few sequences somewhere?

• 0 views • link
written by Gabriel R. Gabriel R.

0 answers

No answers yet.

Log in to answer this question.

More posts like this