read strand identification from sam file
I have sam files (aligned RNAseq to genome) and converted the bam files to sam file. I am working with python. in my pipeline I need to know the strand of the reads. the following lines are 2 examples of the reads that I have in my sam file:
D00645:305:CCVLRANXX:1:1104:13111:49466 272 chr1 35222 0 31M * 0 0 CAAGTGTTTAGAGCTTAATCGTGTTCAAAAT GGGGGGCCGFGGGGC<0F>BGF1F/BEGGGG AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i :0 NM:i:0 MD:Z:31 YT:Z:UU NH:i:6 CC:Z:chr12 CP:i:68440 HI:i:0
D00645:305:CCVLRANXX:1:2203:2308:37794 272 chr1 35222 0 31M * 0 0 CAAGTGTTTAGAGCTTAATCGTGTTCAAAAT GGGEGGGGGGGGGGGGGGGGGEGGGGGGGGG AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:31 YT:Z:UU NH:i:6 CC:Z:chr12 CP:i:68440 HI:i:0
do you know how I can identify the strand of these 2 reads. I actually looked it up but did not find any solution.
• 2,555 views
•
link
1 answer
in second column : samflag 172 -> https://broadinstitute.github.io/picard/explain-flags.html -> read is UNMAPPED (while its' mate is mapped on reverse strand )
in second column : samflag 272 -> https://broadinstitute.github.io/picard/explain-flags.html -> read reverse strand
• 1 views
•
link
Log in to answer this question.