Biostar Beta. Not for public use.
a5 Miseq pipeline error
0
Entering edit mode
12 months ago
ambrinaakbar • 10
@ambrinaakbar43123

I am using a5 Miseq pipeline but facing error while running example files of phix as well as sample files. [a5] ERROR:Unable to identify any properly paired reads [a5] ERROR: Please check that you have provided at least one library of paired-end reads with names conforming to the Illumina read pair convention.

Kindly help me out!

assembly softwareerror next-gen • 627 views
ADD COMMENTlink
0
Entering edit mode

What is the command-line you are running?

ADD REPLYlink
0
Entering edit mode
perl /home/ambrina/a5_miseq_linux_20160825/bin/a5_pipeline.pl /home/ambrina/a5_miseq_linux_20160825/example/phiX_p1.fastq /home/ambrina/a5_miseq_linux_20160825/example/phiX_p2.fastq microbeslinux
ADD REPLYlink
1
Entering edit mode

Don't add comments as answers, add them as comments to the appropriate question / answer / comment. Could you fix this?

ADD REPLYlink
0
Entering edit mode

And what is the output of:

awk 'NR%4==1' /home/ambrina/a5_miseq_linux_20160825/example/phiX_p1.fastq | head

And

awk 'NR%4==1' /home/ambrina/a5_miseq_linux_20160825/example/phiX_p2.fastq | head
ADD REPLYlink
0
Entering edit mode
microbeslinux@microbeslinux:~$ perl /home/ambrina/a5_miseq_linux_20160825/bin/a5_pipeline.pl /home/ambrina/a5_miseq_linux_20160825/example/phiX_p1.fastq /home/ambrina/a5_miseq_linux_20160825/example/phiX_p2.fastq microbeslinux
[a5] Found the following libraries:
     raw1:
      id=raw1
      p1=/home/ambrina/a5_miseq_linux_20160825/example/phiX_p1.fastq
      p2=/home/ambrina/a5_miseq_linux_20160825/example/phiX_p2.fastq
[a5] Found 1 libraries
[a5] Starting pipeline at step 1
[a5] Cleaning reads with SGA
[a5] Cleaning reads with SGA
cleaning each PE lib

p1 is /home/ambrina/a5_miseq_linux_20160825/example/phiX_p1.fastq
Cleaning reads

[a5] java -Xmx512m -jar '/home/ambrina/a5_miseq_linux_20160825/bin'/trimmomatic.jar SE -threads 4 -phred64  microbeslinux.s1/phiX_p1.fastq.both.fastq microbeslinux.s1/phiX_p1.fastq.trim.fastq ILLUMINACLIP:/home/ambrina/a5_miseq_linux_20160825/bin/../adapter.fasta:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
TrimmomaticSE: Started with arguments: -threads 4 -phred64 microbeslinux.s1/phiX_p1.fastq.both.fastq microbeslinux.s1/phiX_p1.fastq.trim.fastq ILLUMINACLIP:/home/ambrina/a5_miseq_linux_20160825/bin/../adapter.fasta:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'TCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT'
Using PrefixPair: 'AGATGTGTATAAGAGACAG' and 'AGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCCGAGCCCACGAGAC'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTGACGCTGCCGACGA'
Using Long Clipping Sequence: 'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'GCCTCCCTCGCGCCATCAGAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'GCCTTGCCAGCCCGCTCAGAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT'
Using Long Clipping Sequence: 'AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGA'
Using Long Clipping Sequence: 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
Using Long Clipping Sequence: 'TTTTTTTTTTAATGATACGGCGACCACCGAGATCTACAC'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCTGATGGCGCGAGGGAGGC'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCTGAGCGGGCTGGCAAGGC'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
Using Long Clipping Sequence: 'TTTTTTTTTTCAAGCAGAAGACGGCATACGA'
Using Long Clipping Sequence: 'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'TCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT'
ILLUMINACLIP: Using 3 prefix pairs, 16 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 6400 Surviving: 6371 (99.55%) Dropped: 29 (0.45%)
TrimmomaticSE: Completed successfully
[a5] '/home/ambrina/a5_miseq_linux_20160825/bin'/sga preprocess -q 25 -f 20 -m 35  --pe-mode=0 --phred64  microbeslinux.s1/phiX_p1.fastq.trim.fastq > microbeslinux.s1/phiX_p1.fastq.both.pp 2> /dev/null
[a5] sga index -d 494097 -t 4 microbeslinux.s1/microbeslinux.pp.fastq > microbeslinux.s1/index.out 2> microbeslinux.s1/index.err
[a5] '/home/ambrina/a5_miseq_linux_20160825/bin'/sga correct -t 4 -p microbeslinux.pp -o microbeslinux.s1/phiX_p1.fastq.both.pp.ec.fastq microbeslinux.s1/phiX_p1.fastq.both.pp > microbeslinux.s1/raw1.correct.out
sh: 1: /home/ambrina/a5_miseq_linux_20160825/bin/sga: Permission denied
readline() on closed filehandle TDPIPE at /home/ambrina/a5_miseq_linux_20160825/bin/a5_pipeline.pl line 503.
Running cat microbeslinux.s1/phiX_p1.fastq.both.repair.fastq >> microbeslinux.s1/microbeslinux.ec.fastq
Done merging libraries
[a5] ERROR: Unable to identify any properly paired reads
[a5] ERROR: Please check that you have provided at least one library of paired-end reads with names conforming to the Illumina read pair convention.
ADD REPLYlink
0
Entering edit mode

I asked for the output of the commands:

awk 'NR%4==1' /home/ambrina/a5_miseq_linux_20160825/example/phiX_p1.fastq | head

And

awk 'NR%4==1' /home/ambrina/a5_miseq_linux_20160825/example/phiX_p2.fastq | head

But anyway, the problem is with the SGA binary from A5_MiSeq:

sh: 1: /home/ambrina/a5_miseq_linux_20160825/bin/sga: Permission denied

If you are luck it is just a matter of setting sga execute permissions, but you may even have to recompile it.

ADD REPLYlink
0
Entering edit mode

yes it works. but now I am having following error [a5] Found only 3168 read pairs in library [a5] Using 3168 read pairs for mapping [a5] java -jar -Xmx512m '/home/ambrina/a5_miseq_linux_20160825/bin'/GetInsertSize.jar test.raw1.sub.pe.sam [a5] Printing preprocessed library file to test.preproc.libs [a5] Processed libraries: raw1: id=raw1 p1=test.s1/phiX_p1.fastq.split.r1.fq p2=test.s1/phiX_p1.fastq.split.r2.fq rc=0 ins=185 err=0.551 nlibs=1 libfile=test.library_1.txt [a5_s3] Scaffolding contigs from test.contigs.fasta with SSPACE [a5_s3] Scaffolding contigs from test.contigs.fasta with SSPACE [a5] Total contig length 5469 [a5] raw1: Insert 185, coverage 49.82, expected links 107 [a5] SSPACE -m 16 -n 10 -k 2 -a 0.4 -o 1 -x 0 -l test.library_1.txt -s test.contigs.fasta -b test.raw1 -d test.s3 > test.s3/test.raw1.out

Bowtie-build error; -1 at /home/ambrina/a5_miseq_linux_20160825/bin/SSPACE/bin/mapWithBowtie.pl line 43.

Bowtie-build error; -1 at /home/ambrina/a5_miseq_linux_20160825/bin/SSPACE/bin/mapWithBowtie.pl line 43. [a5_s4] Detecting and breaking misassemblies in test.crude.scaffolds.fasta with A5QC Illegal division by zero at /home/ambrina/a5_miseq_linux_20160825/bin/a5_pipeline.pl line 1556, <readfile> line 25344.

ADD REPLYlink

Login before adding your answer.

Similar Posts
Loading Similar Posts
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.3