Biostar Beta. Not for public use.
a5 Miseq pipeline error
0
Entering edit mode
12 months ago
ambrinaakbar • 10

I am using a5 Miseq pipeline but facing error while running example files of phix as well as sample files. [a5] ERROR:Unable to identify any properly paired reads [a5] ERROR: Please check that you have provided at least one library of paired-end reads with names conforming to the Illumina read pair convention.

Kindly help me out!

ADD COMMENTlink
0
Entering edit mode

What is the command-line you are running?

ADD REPLYlink
0
Entering edit mode
perl /home/ambrina/a5_miseq_linux_20160825/bin/a5_pipeline.pl /home/ambrina/a5_miseq_linux_20160825/example/phiX_p1.fastq /home/ambrina/a5_miseq_linux_20160825/example/phiX_p2.fastq microbeslinux
ADD REPLYlink
1
Entering edit mode

Don't add comments as answers, add them as comments to the appropriate question / answer / comment. Could you fix this?

ADD REPLYlink
0
Entering edit mode

And what is the output of:

awk 'NR%4==1' /home/ambrina/a5_miseq_linux_20160825/example/phiX_p1.fastq | head

And

awk 'NR%4==1' /home/ambrina/a5_miseq_linux_20160825/example/phiX_p2.fastq | head
ADD REPLYlink
0
Entering edit mode
microbeslinux@microbeslinux:~$ perl /home/ambrina/a5_miseq_linux_20160825/bin/a5_pipeline.pl /home/ambrina/a5_miseq_linux_20160825/example/phiX_p1.fastq /home/ambrina/a5_miseq_linux_20160825/example/phiX_p2.fastq microbeslinux
[a5] Found the following libraries:
     raw1:
      id=raw1
      p1=/home/ambrina/a5_miseq_linux_20160825/example/phiX_p1.fastq
      p2=/home/ambrina/a5_miseq_linux_20160825/example/phiX_p2.fastq
[a5] Found 1 libraries
[a5] Starting pipeline at step 1
[a5] Cleaning reads with SGA
[a5] Cleaning reads with SGA
cleaning each PE lib

p1 is /home/ambrina/a5_miseq_linux_20160825/example/phiX_p1.fastq
Cleaning reads

[a5] java -Xmx512m -jar '/home/ambrina/a5_miseq_linux_20160825/bin'/trimmomatic.jar SE -threads 4 -phred64  microbeslinux.s1/phiX_p1.fastq.both.fastq microbeslinux.s1/phiX_p1.fastq.trim.fastq ILLUMINACLIP:/home/ambrina/a5_miseq_linux_20160825/bin/../adapter.fasta:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
TrimmomaticSE: Started with arguments: -threads 4 -phred64 microbeslinux.s1/phiX_p1.fastq.both.fastq microbeslinux.s1/phiX_p1.fastq.trim.fastq ILLUMINACLIP:/home/ambrina/a5_miseq_linux_20160825/bin/../adapter.fasta:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'TCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT'
Using PrefixPair: 'AGATGTGTATAAGAGACAG' and 'AGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCCGAGCCCACGAGAC'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTGACGCTGCCGACGA'
Using Long Clipping Sequence: 'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'GCCTCCCTCGCGCCATCAGAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'GCCTTGCCAGCCCGCTCAGAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT'
Using Long Clipping Sequence: 'AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGA'
Using Long Clipping Sequence: 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
Using Long Clipping Sequence: 'TTTTTTTTTTAATGATACGGCGACCACCGAGATCTACAC'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCTGATGGCGCGAGGGAGGC'
Using Long Clipping Sequence: 'CTGTCTCTTATACACATCTCTGAGCGGGCTGGCAAGGC'
Using Long Clipping Sequence: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
Using Long Clipping Sequence: 'TTTTTTTTTTCAAGCAGAAGACGGCATACGA'
Using Long Clipping Sequence: 'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG'
Using Long Clipping Sequence: 'TCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT'
ILLUMINACLIP: Using 3 prefix pairs, 16 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Reads: 6400 Surviving: 6371 (99.55%) Dropped: 29 (0.45%)
TrimmomaticSE: Completed successfully
[a5] '/home/ambrina/a5_miseq_linux_20160825/bin'/sga preprocess -q 25 -f 20 -m 35  --pe-mode=0 --phred64  microbeslinux.s1/phiX_p1.fastq.trim.fastq > microbeslinux.s1/phiX_p1.fastq.both.pp 2> /dev/null
[a5] sga index -d 494097 -t 4 microbeslinux.s1/microbeslinux.pp.fastq > microbeslinux.s1/index.out 2> microbeslinux.s1/index.err
[a5] '/home/ambrina/a5_miseq_linux_20160825/bin'/sga correct -t 4 -p microbeslinux.pp -o microbeslinux.s1/phiX_p1.fastq.both.pp.ec.fastq microbeslinux.s1/phiX_p1.fastq.both.pp > microbeslinux.s1/raw1.correct.out
sh: 1: /home/ambrina/a5_miseq_linux_20160825/bin/sga: Permission denied
readline() on closed filehandle TDPIPE at /home/ambrina/a5_miseq_linux_20160825/bin/a5_pipeline.pl line 503.
Running cat microbeslinux.s1/phiX_p1.fastq.both.repair.fastq >> microbeslinux.s1/microbeslinux.ec.fastq
Done merging libraries
[a5] ERROR: Unable to identify any properly paired reads
[a5] ERROR: Please check that you have provided at least one library of paired-end reads with names conforming to the Illumina read pair convention.
ADD REPLYlink
0
Entering edit mode

I asked for the output of the commands:

awk 'NR%4==1' /home/ambrina/a5_miseq_linux_20160825/example/phiX_p1.fastq | head

And

awk 'NR%4==1' /home/ambrina/a5_miseq_linux_20160825/example/phiX_p2.fastq | head

But anyway, the problem is with the SGA binary from A5_MiSeq:

sh: 1: /home/ambrina/a5_miseq_linux_20160825/bin/sga: Permission denied

If you are luck it is just a matter of setting sga execute permissions, but you may even have to recompile it.

ADD REPLYlink
0
Entering edit mode

yes it works. but now I am having following error [a5] Found only 3168 read pairs in library [a5] Using 3168 read pairs for mapping [a5] java -jar -Xmx512m '/home/ambrina/a5_miseq_linux_20160825/bin'/GetInsertSize.jar test.raw1.sub.pe.sam [a5] Printing preprocessed library file to test.preproc.libs [a5] Processed libraries: raw1: id=raw1 p1=test.s1/phiX_p1.fastq.split.r1.fq p2=test.s1/phiX_p1.fastq.split.r2.fq rc=0 ins=185 err=0.551 nlibs=1 libfile=test.library_1.txt [a5_s3] Scaffolding contigs from test.contigs.fasta with SSPACE [a5_s3] Scaffolding contigs from test.contigs.fasta with SSPACE [a5] Total contig length 5469 [a5] raw1: Insert 185, coverage 49.82, expected links 107 [a5] SSPACE -m 16 -n 10 -k 2 -a 0.4 -o 1 -x 0 -l test.library_1.txt -s test.contigs.fasta -b test.raw1 -d test.s3 > test.s3/test.raw1.out

Bowtie-build error; -1 at /home/ambrina/a5_miseq_linux_20160825/bin/SSPACE/bin/mapWithBowtie.pl line 43.

Bowtie-build error; -1 at /home/ambrina/a5_miseq_linux_20160825/bin/SSPACE/bin/mapWithBowtie.pl line 43. [a5_s4] Detecting and breaking misassemblies in test.crude.scaffolds.fasta with A5QC Illegal division by zero at /home/ambrina/a5_miseq_linux_20160825/bin/a5_pipeline.pl line 1556, <readfile> line 25344.

ADD REPLYlink

Login before adding your answer.

Similar Posts
Loading Similar Posts
Powered by the version 2.1