Most of the ideas in this post are already in the original question. Unless you add actual code or more details this would be moved to a comment instead. If you have code snippets/workflow available you can host that via a gist on GitHub and include the link here.
Hi,
Using STAR and a reference fasta file with both the genomes of mouse and plasmodium I've mapped my fastq files (with reads from both mouse and plasmodium). I used a GFF annotation file too in the alignment. Now I have BAM files with reads mapped uniquely to mouse or plasmodium genome and multimapped to both mouse and plasmodium.
I'm interested on extracting the uniquely mapped reads of mouse, the uniquely mapped reads from plasmodium and the multimapped reads.
Since the uniquely mapped reads in the BAM file could be from mouse or plasmodium, I was wondering how can I extract the uniquely mapped reads from each specie. My first idea is to use bamtools/bedtools with the GFF file but I'm unsure about how to do this. Any ideas?
Thanks in advance and thanks for reading.
1 answer
I did this recently but I aligned with bowtie2. Please note I provide code but you would have to modify it slightly for your case.
To create the genome index, I edited the chromosome names in each genome fasta file. So instead of chr1, chr2, chr3... I made it hg_chr1, hg_chr2, hg_chr3. And likewise for the other genome fasta.
e.g.
zcat Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz | \
sed -E "s/>(.+)( dna:.+)/>chr\1_hg38\2/" > hg38.tmp
zcat Mus_musculus.GRCm38.dna.primary_assembly.fa.gz | \
sed -E "s/>(.+)( dna:.+)/>chr\1_mm10\2/" > mm10.tmp
cat hg38.tmp | cat - mm10.tmp > hg38_mm10.fa
rm hg38.tmp
rm mm10.tmp
Then I combined both genome files with the unique chromosome IDs and used that as the index.
bowtie2-build --threads 8 -f ./hg38_mm10.fa hg_mm
After alignment, you can easily distinguish which genome each read is aligned to based on the chromosome name (hg_chr1 vs mm_chr1). I used the XS:i flag in the BAM file to only pull out uniquely mapped reads. It may sound like a lot of work but it was pretty simple to execute.
Here was the more complicated part of separating the BAM into each species with only unique reads.
for file in *.sam
do
# filter out multimappers (reads with 'XS:i' inform us of multimapping)
cat $file | grep -v 'XS:i' > tmp.unique.sam
# filter for high quality reads and convert to bam (below)
samtools view -b -@ 6 -q 35 *unique.sam > tmp.filt.unique.bam
rm tmp.unique.sam
# split into separate human and mouse sam files
samtools view tmp.filt.unique.bam | grep -E $'\tchr.+hg38' > hg38.noheader.sam
samtools view -H tmp.filt.unique.bam | grep -v 'mm10' | cat - hg38.noheader.sam | sed 's/_hg38//' | \
samtools view -b -@ 6 > ./hg38/"${file:0:-4}".hg38.bam
rm hg38.noheader.sam
##
samtools view tmp.filt.unique.bam | grep -E $'\tchr.+mm10' > mm10.noheader.sam
samtools view -H tmp.filt.unique.bam | grep -v 'hg38' | cat - mm10.noheader.sam | sed 's/_mm10//' | \
samtools view -b -@ 6 > ./mm10/"${file:0:-4}".mm10.bam
rm mm10.noheader.sam
##
rm tmp.filt.unique.bam
done
It's unclear in the question how they did the alignment. If the chromosome names are unique as I'm suggesting, then it's simple to pull out reads from either organism with grep. I suggested using XS:i to only take uniquely mapped reads, which I don't see mentioned above. Move my post wherever you'd like though.
Thanks for adding the example code.
Give the bbsplit.sh method suggested above a try as a simpler alternative in future :-)
Hi,
Thanks for your answer. That's an interesting approach and it'll be very helpful if you can provide explanation/code about how you did it.
Many thanks.
Sure I will edit my answer to include some code
Hi goodez,
Thank you for the answer and the code. I do have unique chromosome names for each genome, so the file looks like
7001289F:143:CBY2FANXX:1:1107:2105:1964 99 chr11 96938063 255 1S124M = 96938130 192 NGACCCAGGCTGAAGTGGGGGATCAACACAGGACAAGGTTGCCTCGGGAGGAGCCTTTGTTAGTGACAGAGGCTGAAGCACACAGCCACAAAGTCAAAACAAGGCAAGTGTGTCCAGGGTGATAA
#<<@AF;EGEGGGGGGG>FGGGGGEGGGGGEGGGGGGGGGFGGGFGGGGGGDGGGGGGGGGGGGEGGF>GEGGGBGGGGGE>DBGGGBGBGGG0;0F@DGGGE=@FGGGE@@DBGEGGG.@D6EG NH:i:1 HI:i:1 AS:i:247 nM:i:0
My idea us to use chr*, 255 (MAPQ) and NH:i:1 to extract the unique mapped reads of mouse, and the same but changing the chr for the appropriate name to extract the unique mapped reads of plasmodium. I was thinking to use grep or samtools. Do you think this is a good approach? To filter for both MAPQ and NH:i:x?
Thanks for your time and help.
Yes that sounds good to me
Log in to answer this question.
I suggest that you should try
bbsplit.shas noted in this thread (A: Tool to separate human and mouse ran seq reads ). It will make this process much simpler.You can filter your original fastq files using BBSplit.sh
@Antonio: I am moving this to a comment since this is not an answer for the original question but an alternate way of achieving the end result OP wants.
Many thanks genomax and Antonio,
I've came across with this tool which I found very useful. However, my end goal is to see hoy many reads across samples are from mouse and how many are from plasmodium from the total number of reads. That being so (maybe I'm wrong) but I thought filtering the fastq files before will be easier but won't allow me to see "the big picture" about the distribution of reads per species in my samples. Can I make this comparison with the fastq files filtered? Should I align afterwards with the same reference file and have two different bam files per sample (one with unique mouse reads and other with unique plasmodium reads)?
Again, many thanks for your help.
You are not filtering the reads but actually binning them into pools by using
bbsplit.sh(by aligning them to the references provided). This allows you to find uniquely mapping reads for each genome and get then in individual files. The program will also bin reads that multi-map across species in separate (ambiguous data) files. While it is possible to getbamfiles directly frombbsplit.shit is better to do the split and then do alignments on split data files withbbmap.shto avoid issues visualizing the data with a genome viewer like IGV.