This is a test version of Biostars. For the public version, visit https://www.biostars.org.
bowtie2 paired end read alignment yieldsscaffold information for unmapped reads

The command I used:

bowtie2 --fr -p 30 -x $GENOME -I 200 -X 800 -1 $READ1 -2 READ2 -S $SAM

I wanted to extract unmapped reads. When using samtools view -f0x4 I obtain unmapped pairs and pairs where one of the mates is mapped and the other is not mapped. In the latter case, both mates have a scaffold assignment. Second line, 69 flag --> read itself is unaligned.Looks like this is normal behavior however it is not intuitive at all.

7001253F:534:CBPYUANXX:1:1106:1173:2204#GTGAAA  137     scaffold1402    100976  42      43M     =       100976  0       CTAGATTTTGACGATGGGAAAAGGAAAAAAATAAAGAAAAGAT     B<BB/F<FFFFFF/FFFFFFFFFFFBFFFFFBBBB<
7001253F:534:CBPYUANXX:1:1106:1173:2204#GTGAAA  69      scaffold1402    100976  0       *       =       100976  0       AACGTATTATACATATATATTATATATATATATGTGTATGTGTATATATATATATATATATATATAATGTTCTATACATAGAAC

My question is: Do you know why this is done? Is this a bug?

bowtie2 read alignment tlen unmapped
• 1,552 views • link
updated by Biostar Biostar • written by al.bodrug al.bodrug

0 answers

No answers yet.

Log in to answer this question.

More posts like this