I'm trying to download an appropriate reference genome for use in reference calling a bunch of reads I have for zebrafish. The reads I have are from the 10x platform looking at single cell RNA transcripts. Currently I have a BAM file and would like to create a vcf file of variant sites within my reads.
I have a sorted file sorted_QC.bam of reads coming from cells which have previously passed QC. In order to do variant calling I want to run something of the form:
bcftools mpileup --ignore-RG -f <ref.fa> sorted_QC.bam | bcftools call -mv -O v -o <out.vcf>
For use as a reference I used the GRCz11 genome build from Ensembl and chose to include
- cDNA sequences
- Transcript Stable ID
- Gene Name
- Gene Stable ID
- Chromosome/Scaffold name
This is a sample of the fasta file:
>ENSDARG00000033231|ENSDART00000000042|mcm6l|2|50199738|50225495
TTACCTGCTCCAGGTGTGCGTGTGTTGGTCGAGTGATGGAGCCTGGTGTCGAAGCGGCGG
GCGTGCACGTGCGCGATGAACTGTCCGAGAAGTGTCAGAAGTTGTTTCTGGAGTTTTTGG
AAGAGTTTCAGGATAAAAACGGCGACGCTCTATATCTGTCGGACGCGCAGGAGCTGATCC
GACCGGAGAGAAACACGCTGACCGTGAGCTTCAGCAACATCGAGCACTACAACCAGCAGC
TCGCCACCACCATCCAGGAGGAGTACTACAGGGTTTATCCGTTTCTCTGCAGAGCAGTTC
GTCACTTTGCCAGAGATCATGGAAATATTCCACCTTCCAAAGAGTTTTATGTGGCTTTTT
CGGAGTTTCCATCAAGGCAAAAGATTCGTGAGCTCTCCACTGTACGTATTGGCACTTTGT
TGCGCATCAGCGGTCAGGTGGTCCGAACCCACCCTGTGCACCCAGAGCTGGTCAGCGGCA
CCTTCCTCTGCCTGGACTGTCAGTCGGTCATCAAAGATGTGGAGCAGCAGTTCAAATACA
I only included unique results and once I had the fasta file I ran
samtools faidx <ref.fa>
to create <ref.fa.fai>
However, when i run the command I get the following error:
[E::faidx_fetch_seq] The sequence "1" not found
over and over again. I checked the faidx file and this is how it looked:
ENSDARG00000033231|ENSDART00000000042|mcm6l|2|50199738|50225495 2585 65 60 61
ENSDARG00000000370|ENSDART00000000382|triob|16|8751815|8927425 8958 2758 60 61
ENSDARG00000076182|ENSDART00000000280|stat1b|9|41218967|41247197 4113 11932 60 61
ENSDARG00000000183|ENSDART00000000192|ptpn4b|22|11778053|11833334 6443 16181 60 61
ENSDARG00000000151|ENSDART00000000160|thraa|3|34688022|34753605 2292 22797 60 61
ENSDARG00000000241|ENSDART00000000250|slc40a1|9|41103127|41113878 3780 25195 60 61
ENSDARG00000000068|ENSDART00000000069|slc9a3r1a|12|33484458|33537126 2033 29109 60 61
ENSDARG00000000069|ENSDART00000000070|dap|24|22070290|22103585 1859 31240 60 61
ENSDARG00000000002|ENSDART00000000005|ccdc80|9|34089156|34113209 2604 33196 60 61
ENSDARG00000036830|ENSDART00000000221|krt91|19|5378563|5380770 1582 35908 60 61
As a reference, this is a sample of the top of the header of my .bam file:
@HD VN:1.4 SO:coordinate
@SQ SN:1 LN:58871917
@SQ SN:10 LN:45574255
@SQ SN:11 LN:45107271
@SQ SN:12 LN:49229541
@SQ SN:13 LN:51780250
@SQ SN:14 LN:51944548
@SQ SN:15 LN:47771147
@SQ SN:16 LN:55381981
@SQ SN:17 LN:53345113
I believe I may have a problem with mpileup or faidx not being able to locate chromosome 1 in either of the files. However, i'm not sure exactly in what way I should edit the files to fix this. Alternatively, should I be using a different file as my reference genome?
Thanks!
1 answer
It can't locate the chromosomes because in the bam they are named 1, 2, and so on; and in the fasta reference they are named ENSDARG00000033231|ENSDART00000000042|mcm6l|2|50199738|50225495. You have to use the same reference used to map the files.
Just a comment / question, your example commands wrap file names around <>, like <ref.fa> and <out.vcf>. Do your real commands use <>, or are they used here just to demonstrate an example file name? Because > and < have special for bash, they redirect input and output, and should not be used in your commands.
Log in to answer this question.
I will give a try just having the chromosome number - however, how will mpileup know where these variants actually lie if it just has the chromosome and sequence? Does it work out it out?
As for the comment - sorry that is very ambiguous from me. It is essentially just because i couldnt remember exactly what I had called my reference fasta file when i wrote the question! I don't think I have been misplacing symbols all over the place..
Thanks!
Please use the
ADD COMMENTbutton when replying to someone's answer.