This is a test version of Biostars. For the public version, visit https://www.biostars.org.
I loaded a DNA-seq BAM file in IGV but I can't see anything

I loaded a BAM file in IGV but I can't see anything. My reference genome is Human hg19. I don't know which chromosome to choose and which region to zoom in.

I tried to read the BAM file header with samtools but I don't understand what information to extract:

I wrote that in the terminal

 samtools view -h [bamfile] | head -100

OUTPUT

 aln.bam | head -88
@HD VN:1.0  SO:unsorted

@SQ SN:1    LN:249250621

@SQ SN:2    LN:243199373

@SQ SN:3    LN:198022430

@SQ SN:4    LN:191154276

@SQ SN:5    LN:180915260

@SQ SN:6    LN:171115067

@SQ SN:7    LN:159138663

@SQ SN:8    LN:146364022

@SQ SN:9    LN:141213431

@SQ SN:10   LN:135534747

@SQ SN:11   LN:135006516

@SQ SN:12   LN:133851895

@SQ SN:13   LN:115169878

@SQ SN:14   LN:107349540

@SQ SN:15   LN:102531392

@SQ SN:16   LN:90354753

@SQ SN:17   LN:81195210

@SQ SN:18   LN:78077248

@SQ SN:19   LN:59128983

@SQ SN:20   LN:63025520

@SQ SN:21   LN:48129895

@SQ SN:22   LN:51304566

@SQ SN:X    LN:155270560

@SQ SN:Y    LN:59373566

@SQ SN:MT   LN:16569

@SQ SN:GL000207.1   LN:4262

@SQ SN:GL000226.1   LN:15008

@SQ SN:GL000229.1   LN:19913

@SQ SN:GL000231.1   LN:27386

@SQ SN:GL000210.1   LN:27682

@SQ SN:GL000239.1   LN:33824

@SQ SN:GL000235.1   LN:34474

@SQ SN:GL000201.1   LN:36148

@SQ SN:GL000247.1   LN:36422

@SQ SN:GL000245.1   LN:36651

@SQ SN:GL000197.1   LN:37175

@SQ SN:GL000203.1   LN:37498

@SQ SN:GL000246.1   LN:38154

@SQ SN:GL000249.1   LN:38502

@SQ SN:GL000196.1   LN:38914

@SQ SN:GL000248.1   LN:39786

@SQ SN:GL000244.1   LN:39929

@SQ SN:GL000238.1   LN:39939

@SQ SN:GL000202.1   LN:40103

@SQ SN:GL000234.1   LN:40531

@SQ SN:GL000232.1   LN:40652

@SQ SN:GL000206.1   LN:41001

@SQ SN:GL000240.1   LN:41933

@SQ SN:GL000236.1   LN:41934

@SQ SN:GL000241.1   LN:42152

@SQ SN:GL000243.1   LN:43341

@SQ SN:GL000242.1   LN:43523

@SQ SN:GL000230.1   LN:43691

@SQ SN:GL000237.1   LN:45867

@SQ SN:GL000233.1   LN:45941

@SQ SN:GL000204.1   LN:81310

@SQ SN:GL000198.1   LN:90085

@SQ SN:GL000208.1   LN:92689

@SQ SN:GL000191.1   LN:106433

@SQ SN:GL000227.1   LN:128374

@SQ SN:GL000228.1   LN:129120

@SQ SN:GL000214.1   LN:137718

@SQ SN:GL000221.1   LN:155397

@SQ SN:GL000209.1   LN:159169

@SQ SN:GL000218.1   LN:161147

@SQ SN:GL000220.1   LN:161802

@SQ SN:GL000213.1   LN:164239

@SQ SN:GL000211.1   LN:166566

@SQ SN:GL000199.1   LN:169874

@SQ SN:GL000217.1   LN:172149

@SQ SN:GL000216.1   LN:172294

@SQ SN:GL000215.1   LN:172545

@SQ SN:GL000205.1   LN:174588

@SQ SN:GL000219.1   LN:179198

@SQ SN:GL000224.1   LN:179693

@SQ SN:GL000223.1   LN:180455

@SQ SN:GL000195.1   LN:182896

@SQ SN:GL000212.1   LN:186858

@SQ SN:GL000222.1   LN:186861

@SQ SN:GL000200.1   LN:187035

@SQ SN:GL000193.1   LN:189789

@SQ SN:GL000194.1   LN:191469

@SQ SN:GL000225.1   LN:211173

@SQ SN:GL000192.1   LN:547496

@RG ID:Bordet_EGFR_S1   SM:S1   PL:Illumina

@PG ID:bowtie2  PN:bowtie2  VN:2.0.2
M01636:3:000000000-A442D:1:1102:18789:14479 99  1   326181  1   11S140M =   326217  189 CACACTGACGTGCCTCTCCAGACCCACTTGCACCCTCCGGGCGTTCTCTCCGGGCCCAGCTCTTCTTCCTGGTTGGGTCTCCAGGCCCGATTCCTGCCTCTCAACAACCTCTTTGGACTCAGTGCCTACCCATCTCCTGGCGGCCTTGGTC BBBBBFFFFBBAEGGGGGGGGGGHHHCFHHHGHHGHGGGGGGGGCFFHHHHGGGGEGDHHGFGG3FGHHHFEGHEGGGGHHFHHGEFFGGGGH4FGEGFFHGHFGHFHGHHHFHGHHGHHHFBHHFHBHHGHHHHHFFFHG-CGGDGFHHB AS:i:280    XS:i:280    XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:140    YS:i:275    YT:Z:CP RG:Z:Bordet_EGFR_S1

How to find the correct chromosome and the region of interest?

Thanks

next-gen sequence alignment gene

3 answers

I think you need to sort and index the bam file using samtools before you can see anything in IGV.

@mastal511 I have the [bam.bai] file in the same folder as the bam file. Is that what I have to do? How do I sort the bam file?

Did you sort the BAM file before indexing it (which creates the .bai file)?

Actually my instructor sent me 4 files:

- aln1.fastq
- aln2.fastq
- aln.bam
- aln.bam.bai

That's why I was thinking that it was already sorted. As genomax2 said it's maybe because my reference genome is not hg19. How can I set it as reference in samtools?

Your BAM file header is showing that it is unsorted. You should sort and then index again.

@HD VN:1.0  SO:unsorted
samtools sort aln.bam aln.sort
samtools index aln.sort.bam

In addition to @mastal511's suggestion it looks like you have "ensembl" version of the genome/annotation where as the default "genome" in IGV is UCSC (which uses chr1 etc). So you may need to load the ensembl version of hg19 in IGV as a "new genome".

@genomax2 I downloaded the hg19 reference genome. How do I set it as new reference?

Is your data aligned to ensembl's hg19?

The instruction says:

raw file is aligned to hg19 human genome.

Sources use different nomenclature for same genome build (e.g. UCSC uses chr1 where as ensembl has just 1).

actually IGV can handle the chr1 vs 1 matching nowadays (one small step for man, one giant leap for mankind)

In addition to mastal511 and genomax2 suggestions, have you zoomed enough?

Log in to answer this question.