Hi all!

How can I allow for ambiguous matching to a reference sequence? I have a 4 base barcode proceeding my sequences which I need to preserve.

This is my pipeline:

bwa index amp.fa

samtools faidx amp.fa

bwa mem amp.fa file_R1.fastq file_R2.fastq > file.sam

samtools view -bS file.sam > file.bam

samtools sort file.bam > file.sorted.bam

samtools index file.sorted.bam

I then read the sorted BAM file using R with scanBam from Rsamtools and work with it there. Mostly just because I'm a lot more comfortable working with R.

The "amp.fa" file looks like this:

> amp

NNNNATGCATGCATGCATGCATGCATGCATGC

I'd hoped that the Ns would mean any reads aligning to "ATGCATGCATGCATGCATGCATGCATGC" would have the 4 proceeding bases align to "NNNN", so I'd be able to see what they are.

Can anyone suggest an alternative way to do this? Or a tweak to allow the capture of any sequence proceeding position 1 of the know sequence?

Many thanks in advance