HI,
I'm starting a experiment with some cells from mice embryos. I want to be sure, my primers are correct before to do all the experiment.
I'm a little confused how to orders the primers for ATAC-seq: For each sample, I should be order:
Sample1:
Ad1_noMX: (Primer without index) Ad2.1_index: (Primer with index1)
Sample2: Ad1_noMX:(Primer without index) Ad2.2_index: (Primer with index2)
etc
In terms to order the primers if I follow the list from (Jason D Buenrostro paper https://media.nature.com/original/nature-assets/nmeth/journal/v10/n12/extref/nmeth.2688-S1.pdf):
I should be order:
Ad1_noMX: AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG
Basically the second primer I have to put the index sequence to order: index+sequence? Ad2.1_TAAGGCGA: TAAGGCGA-CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT
Thanks
0 answers
No answers yet.
Log in to answer this question.
You should post this over at SeqAnswers.com or biology stackexchange where predominantly experimental questions get quick answers.
Edit: I see that this is already cross-posted at SA.