Fastq files with integer instead of acii quality scores

I was going to align a bunch of old fastq files with bwa and got no result. When I looked into the files, I saw that the base quality is reported as integers as opposed to ascii:

@1_21_9:1:2:1565:591
GTGTTGTTTAGAAGCTGAACTACCTTTTTCGCTGAG
+1_21_9:1:2:1565:591
 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 31 5 40 40 1 40 15 40 40 40 40 40 4 2 40 40 15 1 39
@1_21_9:1:2:1307:745
GATCGGAAGAGCTCGTCTGCCGTCTTCTGCTTTGCT
+1_21_9:1:2:1307:745
 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 4 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 -2 1 1 1

Has anyone ever seen this encoding before and knows a tool that can convert this into proper fastq?

Note that there are negative values as well. Could this be old Solexa quality scores?

sequencing

• 5,176 views • link

updated 8.1 years ago by liartom2 •

• written 8.4 years ago by bgbrink •

That file does not meet fastq format definition. Where did you get this data BTW? Do you know what technology is it from?

• 0 views • link

written 8.4 years ago by GenoMax

I have seen GAIIx data that was in separate sequence and score (as integers) files. Maybe somebody just mashed them together without knowing that they need to be encoded...

• 0 views • link

written 8.4 years ago by cschu181

That could be it. I don't have any hard proof from what technology this data is from though. Does it still make sense to try and convert the scores manually?

• 0 views • link

written 8.4 years ago by bgbrink •

If you have a clue which encoding/phred scale is used you could convert it to a sane fastq, using some scripting. Alternatively you could just convert it to a fasta file and forget about the quality scores...

• 0 views • link

written 8.4 years ago by WouterDeCoster

3 answers

It seems you are using Solexa+64 encoding ( -5 to 40 ). You can convert to ASCII easily helped by the following picture. enter image description here

• 0 views • link

written 8.4 years ago by sacha

I did it for you with awk :

cat myfile.fastq | awk -f convert.awk 

// convert.awk 
function toascii(score)
{
    return sprintf("%c",score + 64)
}


(NR-1) % 4 == 0{
print $0
}

(NR-1) % 4 == 1{
print $0
}

(NR-1) % 4 == 2{
print "+"
}

(NR-1) % 4 == 3{

for (i=1; i <= NF ; i+=1)
    {
        printf(toascii($i))
    }
    printf("\n")
}

• 0 views • link

written 8.4 years ago by sacha

for (i=1; i < NF ; i+=1)

i <= NF, my dude

• 1 views • link

written 8.1 years ago by liartom2 •

Hi liartom2 ,

This reply is better suited as a comment on sacha's answer. Could you make the appropriate change please? That would involve the following steps:

Copy the contents of your reply from this answer (you can edit this answer (Ctrl/Cmd+click link to open it in a new tab) and do a Select All -> Copy)
Click on Add Comment on sacha's post here: A: Fastq files with integer instead of acii quality scores
Paste the copied text
Click on the green Add Comment button
Click on moderate back in your answer here: A: Fastq files with integer instead of acii quality scores
Choose Delete Post
Click on the blue Submit button.

Thank you!

• 1 views • link

written 8.1 years ago by Ram